Labshake search
Citations for Promega :
501 - 550 of 1553 citations for 6 Methyl 5 propyl 4 1H pyrimidinone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2024Quote: ... 5 µM HaloTag PEG-biotin ligand (G859A; Promega) or an equivalent amount of DMSO was added ...
-
bioRxiv - Immunology 2021Quote: ... in a mixture with 20 μl OptiMEM and 1μl FuGENE HD or FuGENE 6 (Promega E2691) per well ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested with Lys-C (Wako Chemicals) for 6 hours and trypsin (Trypsin Gold, Promega) overnight.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were cultured in DMEM+10% FBS+Penicillin/Streptomycin and transfected using FuGENE 6 (Promega). Co-recruitment assays were performed 24 hours after transfection ...
-
bioRxiv - Immunology 2020Quote: All VLPs were produced by transient transfection of HEK293T cells with Fugene 6 (Promega, ref E2691). HEK293T were seeded in 15-cm dishes to reach 60-70% confluency the next day and VLPs were produced by co-transfecting plasmids encoding Gag-eGFP and the VSV-G envelope (pGag-EGFP and pCMV-VSV-G ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: Three wells of a 6-well plate were lysed were lysed in Reporter lysis buffer (Promega) for 10 min on ice before centrifugation at 17,000 g ...
-
bioRxiv - Microbiology 2021Quote: All virus stocks were produced by plasmid transfection of HEK 293T cells with Fugene 6 (Promega). Supernatants were harvested at 48h and 72h ...
-
bioRxiv - Cell Biology 2022Quote: ... and pCMV-hyPBase was performed using 500 ng each DNA and 6 μl of FugeneHD (Promega) as per manufacturer’s instructions20,49,50 ...
-
bioRxiv - Biochemistry 2022Quote: ... Sf21 insect cells were transfected with PLP/DM20 bacmid using Fugene 6 transfection reagent (Promega Corp.) and baculoviruses were collected and used for preparation of a high-titer virus stock ...
-
bioRxiv - Microbiology 2020Quote: Plasmid DNA was combined at a 3:1 ratio of FuGENE® 6 Transfection Reagent (Promega) to DNA and incubated 20 min at RT ...
-
bioRxiv - Molecular Biology 2022Quote: Lentivirus particles were collected from HEK293T cell supernatant 3 days after co-transfection (FuGENE 6, Promega) of lentiviral plasmid constructs (Supplementary Table 2A ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... To transform the bacmid into Sf9 cells the transfection reagent FuGene 6 (Promega Corporation, Madison, USA) was used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were transfected with the pseudovirus encoding plasmids using FuGENE 6 Transfection Reagent (Promega). The virus culture supernatant was harvested at 48h and 72h post transfection and stored at -80°C until use ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5μg of plasmid was transfected into 6-well dishes using Fugene HD (Promega, Madison, WI, USA) with 3:1 transfection reagent to DNA for 24 hours ...
-
bioRxiv - Genetics 2023Quote: ... Transient expression of NSD2 VUS in HeLa cells was performed using FuGENE 6 (Promega, WI, USA). pCMV-3xFLAG-NSD2 and pCMV-3xFLAG-NSD2 c.2714C>T plasmids were constructed by VectorBuilder (IL ...
-
bioRxiv - Biophysics 2023Quote: We stably transfected U2OS cells with this plasmid using Fugene 6 following the manufacturer’s instruction (Promega). α-Amanitin (SIGMA #A2263 ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells plated for transfection were allowed to reach 70% confluency and transfected with FuGene 6 (Promega) according to manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2022Quote: Lipofectamine 3000 or FuGENE 6 transfection reagents (ThermoFisher Scientific/Invitrogen, cat# L3000008; and Promega, cat# E2691) were used for transient delivery of PRR14 plasmids ...
-
bioRxiv - Cell Biology 2023Quote: HeLa cells were transfected using 2 µg of plasmid DNA and 6 µL of FuGENE (Promega) for gene editing or using a NEPA21 electroporation system (Nepa Gene ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transiently transfected with 1.5 μg of plasmid using FuGENE 6 transfection reagent (#E2692, Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell viability was assessed at day 6 post inhibitor treatment using CellTiter Glo 3D (Promega) according to manufacturer’s instruction.
-
bioRxiv - Molecular Biology 2020Quote: ... followed by the addition of 5-μL Endo-H reaction buffer and 5-μL Endo-H (Promega Cat#PRV4875, 2,500-U). Deglycosylation proceeded for 4-hours at 37°C ...
-
bioRxiv - Biophysics 2021Quote: ... was amplified from cDNA samples using primers SC2-protN28182-F (5’-AGTCTTGTAGTGCGTTGTTCG-3’) and SC2-protN29566-R (5’-ATAGCCCATCTGCCTTGTGT-3’) and cloned into pGEM-T Easy (PROMEGA - USA), generating plasmid pGEM-SC2-N ...
-
bioRxiv - Cancer Biology 2020Quote: ... and housekeeping gene HPRT1 (FP: 5’ ATGACCAGTCAACAGGGGACAT 3’, RP: 5’ CAACACTTCGTGGGGTCCTTTTCA 3’) were measured using GoTaq qPCR Master Mix (Promega, A6001) on a TaqMan Viia 7 Real-Time PCR System ...
-
bioRxiv - Developmental Biology 2022Quote: ... CNS1 was amplified by PCR from Xenopus laevis genomic DNA using primers 5’-CCGCTCGAGCAGAGCAGACAGGGTCTGTA −3’ and 5’-CCCAAGCTTTGACCGTCAGTTTCATGACT-3’ and inserted into pGEM®-T Easy vectors (PROMEGA). Then ...
-
bioRxiv - Developmental Biology 2021Quote: ... the adar cDNA sequence was PCR-amplified using the primer pair 5’-CCTGTCTTTGATACTGTCGTG-3’ and 5’-TCCCGAAGCCACAGATTCAC-3’ and cloned into p-GEMT vector (Promega, USA). For the rescue experiment ...
-
bioRxiv - Microbiology 2021Quote: ... The DNA sequence encoding the CA ORF was amplified from the pNL43 plasmid by PCR using a forward primer harboring EcoR1 site (5’- TAAGCAGAATTCCCTATAGTGCAGAACCTCCAGG-3’) and a reverse primer harboring Sal1 site (5’-TCATTAGTCGACTATCACAAAACTCTTGCTTTATGG-3’) and GoTaq DNA polymerase (Promega, USA). The PCR amplicon was gel-purified using the Qiaquick gel purification kit (Qiagen ...
-
bioRxiv - Cell Biology 2022Quote: ... qPCR analysis of Gli1 was performed with primers 5′ CCAACTCCACAGGCATACAGGAT 3′ and 5′ CACAGATTCAGGCTCACGCTTC 3′ using GoTaq® qPCR Master Mix (Promega).
-
bioRxiv - Microbiology 2024Quote: ... 1522bp using primers 5’-AAGGTACCTGAGGCTGGAGAGATGGCC-3’ and 3’-TAAAAGCTTCACCGGACTGGGCTAGTTCAG-5’ were PCR amplified and cloned in promoterless PGL3 enhancer empty vector (Promega, E1771) at the upstream of luciferase gene ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The 16S rRNA gene was amplified using primers 27F-YM 5’-AGAGTTTGATYMTGGCTCAG-3’ and 1391R 5’-GACGGGCGGTGWGTRCA-3’ and GoTaq DNA Polymerase (Promega, USA). The PCR was performed as follows ...
-
bioRxiv - Genomics 2024Quote: ... extracted from 5 HPVL and 5 LPVL (Table S3, Petersen et al., 2021) were treated with the DNase RQ1 (Promega, US). Then ...
-
bioRxiv - Plant Biology 2021Quote: ... the protein suspensions were digested with 4 μg trypsin (Promega) in 40 μl TEAB buffer overnight at 37°C ...
-
bioRxiv - Neuroscience 2023Quote: ... 25 μL of 4 mM luciferin (Assay Reagent, Promega, E1291) supplemented with isoproterenol at a final concentration of 200 nM was added ...
-
bioRxiv - Microbiology 2023Quote: ... the protein suspension was digested with 4 μg trypsin (Promega) in 40 μL NH4HCO3 (50 mM ...
-
bioRxiv - Cell Biology 2023Quote: ... and then 4 hours in mass-spectrometry-grade trypsin (Promega). The missed cleavage rate for samples was an average of 3.9%-21.9% ...
-
bioRxiv - Neuroscience 2023Quote: ... After embedding in 4% low-melting point agarose (Promega, #V2111) in PBS ...
-
bioRxiv - Cancer Biology 2021Quote: ... for 6-8 hours before dual luciferase assay was performed using the Dual-Glo Luciferase Assay (Promega) in a Synergy Neo2 microplate reader (Biotek).
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid transfection of U2OS cells with PIF1 variants was carried out using FuGENE 6 Transfection Reagent (Promega) according to the manufacturer’s protocol.
-
bioRxiv - Cell Biology 2021Quote: HeLa cells were plated at 100,000cells in 2 ml media onto 35mm MatTek glass bottom dishes and transfected with 0.9µg RUSH plasmid and 0.1µg eGFP-GalT or LAMP1-GFP using 100µl Opti-MEM and 3µl Fugene 6 transfection reagent (Promega) one day before imaging ...
-
bioRxiv - Cell Biology 2020Quote: ... samples were incubated for 6 h at 37°C with 3 μg Sequencing Grade Modified Trypsin (Promega). Digestion was terminated via addition of 20 μL trifluoroacetic acid (TFA) ...
-
bioRxiv - Developmental Biology 2020Quote: ... 6 uL of RNA was used for each cDNA synthesis (GoScript™ Reverse Transcription System kit, Promega). qPCR was performed using Fast SYBR Green Master Mix (Applied Biosystems ...
-
bioRxiv - Microbiology 2021Quote: ... following manufacturer’s guidelines and a ratio of 0.5 µg of plasmid:1.5 µL FuGene 6 (Promega, E2691) in Opti-MEM (Gibco) ...
-
bioRxiv - Biochemistry 2020Quote: ... HeLa cells were transiently transfected with the PX459–sgRNF213-exon3 vector using FuGENE 6 Transfection Reagent (Promega). Forty-eight hours post-transfection ...
-
bioRxiv - Cell Biology 2021Quote: ... Transfection was done on pre-seeded HeLa cells (70% confluency) with the FuGENE 6 Transfection Reagent (Promega) following standard protocol ...
-
bioRxiv - Microbiology 2023Quote: ... and 0.25 μg vesicular stomatitis virus G glycoprotein expression plasmids using the Fugene 6 transfection reagent (Promega) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2022Quote: ... mouse Piezo2 (Lewis et al., 2017): 2.5 µg + 0.5 µg YFP) with Fugene 6 (Promega, Madison, WI) 48 hours prior to recording at a transfection ratio of 10 µL Fugene6:3 µg total DNA ...
-
bioRxiv - Systems Biology 2024Quote: ... FuGene 6 (cat#: E2692) transfection reagent and sequencing grade modified trypsin (cat#: V5111) were purchased from Promega. Cas9 endonuclease was purchased from Integrated DNA Technologies ...
-
A CRISPR activation screen identifies FBXO22 as an E3 ligase supporting targeted protein degradationbioRxiv - Biochemistry 2023Quote: ... FuGene 6 (cat#: E2692) transfection reagent and sequencing grade modified trypsin (cat#: V5111) were purchased from Promega. Cas9 endonuclease was purchased from Integrated DNA Technologies.
-
bioRxiv - Cell Biology 2022Quote: eGFP-HSP27 immunoprecipitations were performed in p62KO HeLa cells 24hrs following transient transfection using Fugene 6 (Promega). HeLa cells were treated with 750µM LLOMe for 2hrs prior to immunoprecipitation ...
-
bioRxiv - Cell Biology 2023Quote: ... and 500 ng of pMCB306 plasmids described above along with 3 µl of Fugene 6 (E2692, Promega) transfection reagent ...