Labshake search
Citations for Promega :
451 - 500 of 1553 citations for 6 Methyl 5 propyl 4 1H pyrimidinone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... All transfections were performed using Fugene-6 transfection reagent according manufacturers protocol (Promega, cat E2691).
-
bioRxiv - Biochemistry 2023Quote: ... Transfections of the PX459 constructs were performed individually using FuGENE 6 Transfection Reagent (Promega E2691) according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2023Quote: ... in the presence or absence of indicated expression vectors using FuGene 6 transfection reagent (Promega). 36 hours after transfection ...
-
bioRxiv - Neuroscience 2023Quote: ... ND7/23 cells were transfected with FuGENE® 6 Transfection Reagent (Promega, Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... The vector was transfected into Flp-In™ 293 cells using Fugene 6 (Promega, E269A) and 24 hours later the cells expressing the fluorescent reporter were sorted in a 96 well plate as single cells using the Sony SH800 cell sorter ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were transfected with 6 µg plasmid per plate with FuGENE HD (Promega, E2311) as per the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 148 μl opti-MEM was added to 12 μl FuGENE 6 transfection reagent (Promega, E2691). These solutions were incubated separately for 5 mins at RT ...
-
bioRxiv - Immunology 2024Quote: ... pHIT60 and 10μg pMX/TCR using Fugene-6 according to protocol (Promega, Madison, WI, USA). Transfection medium was changed for T-cell medium after 24h and supernatant was harvested 16 hours later following cell-pelleting ...
-
bioRxiv - Cancer Biology 2024Quote: ... Viability was assessed 6 days post-treatment by using an MTS/PMS (Promega #PR-G1112) solution and reading absorbance at 490 nm on an Infinite M200 Pro plate reader (Tecan ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...
-
bioRxiv - Neuroscience 2023Quote: ... Equilibrated cells were transfected with 0.8 μg of 5-HT1eR or 5-HT1FR and 8 μg of GloSensor plasmid (Promega), after mixing with 17.6 μl of PEI in OptiMEM (Gibco) ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies were incubated in PBDS for 3 days at 4°C followed by 4 washes over the next 24 hours with 0.2% Tween-20 (Promega UK Ltd; H5151) in PBS ...
-
bioRxiv - Cancer Biology 2020Quote: ... 4 μL of CellTiter-Glo® (Promega cat#: G7570) were added to each well and incubated for 15 min at room temperature ...
-
bioRxiv - Cell Biology 2021Quote: ... 4 mM isopropyl β-d-1-thiogalactopyranoside (IPTG; Promega) was added to each RNAi well for induction of dsRNA synthesis and plates were incubated for 3-4 hours at 30°C and 155 rpm ...
-
bioRxiv - Cell Biology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Samples were washed and endogenous biotin was blocked using Avidin/Biotin blocking kit (Vector laboratories ...
-
bioRxiv - Immunology 2021Quote: ... and 4 U/ml RNasin (Promega, Madison, WI, USA). Slides were then incubated with 100 nM insert/backbone oligonucleotides in PBS ...
-
bioRxiv - Biochemistry 2021Quote: ... We identified a common tracer probe (K-4, Promega), suitable for all mutants ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... 4 µL of ONE-Glo™ Luciferase reagent (Promega) was added to each well using the BioRAPTR FRD™ ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 1 μl of 4 mg/ml RNase A (Promega) was added and the sample incubated for 30 min at 37°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... cells were transfected with 4 µL FuGene HD (Promega), 1 µg sgRNA-Cas9 plasmid DNA ...
-
bioRxiv - Biophysics 2022Quote: ... 4% glycerol with 12 units RNasin (Promega, Madison, WI), 10 μg/ml BSA ...
-
bioRxiv - Microbiology 2021Quote: ... Standard RNA was synthesized from a partial region of the GPC gene using the forward (5’-TAATACGACTCACTATAGGGCCAACCTTTTTGCAGGAGGC-3’) and reverse (5’-AGCTTCTTCTGTGCAGGATCTTCCTGCAAGCGCTAGGAAT-3’) primers and the T7 RNA polymerase (Promega), as previously described (Pemba et al. ...
-
bioRxiv - Microbiology 2022Quote: ... The region of recombination was amplified using primers PV3-F2 (5′-CTCCAAAGTCCGCATTTACA-3′) and PV1-R2 (5′-ATCAGGTTGGTTGCTACA-3′) and Taq polymerase (Promega) with an initial denaturing at 95°C for 2 min ...
-
bioRxiv - Microbiology 2020Quote: ... 5 pmol of each primer (C1105 5’-GGTTCATCGACATCTCCGCG-3’ and C1106 5’-AGGTCGCTGCGCATGCCAATC-3’) and 1.25 units of GoTaq® DNA polymerase (Promega). The cycling conditions were as follows ...
-
bioRxiv - Cell Biology 2021Quote: ... a ~600 bp mouse ATF6β cDNA fragment was PCR-amplified using 5’-AACAGGAAGGTTGTCTGCATCAT-3’ and 5’-GTATCCTCCCTCCGGTCAAT-3’ primers and inserted into the pGEM-T vector (Promega). The plasmid was linearized using EcoRV and ApaI to synthesize the antisense and sense probe ...
-
bioRxiv - Genetics 2021Quote: ... A ~1 kb fragment of the blm cDNA was cloned using primers blm-F – 5’-GGAGTCGAAACACCTGGTGGTA-3’ and blm-R – 5’-CTCATCAATGACCAAGCGAGCC-3’ into pGEM-T vector (Promega) following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: A 400-base pair region inside the sequence of the HvCESA1 antisense was amplified by RT-PCR from an oligo dT primed cDNA using 5’TAAGCGCCCAGCTTTCAA and 5’ GATACCTCCAATGACCCAGAAC oligonucleotide primers and GoTaq Green polymerase (Promega). The PCR product was cloned into the pGEM T-Easy vector (Promega) ...
-
bioRxiv - Biochemistry 2022Quote: ... The 400 base pair region surrounding the sgRNA target was then amplified by PCR (forward primer: 5’-CCCAGAGAGGAGGCTGTAGA-3’; reverse primer: 5’-AAAGGCCTCCCAGGGGTTAT-3’) with GoTaq DNA Polymerase (Promega). The resulting PCR product was cloned into the pCR 4-TOPO vector using the TOPO TA Cloning Kit for Sequencing (Invitrogen) ...
-
bioRxiv - Microbiology 2022Quote: RT reaction mix was set up and cDNA products were then amplified by PCR (25 cycles) with specific antigenome forward (5’-CATTCTACGAGCCGGTGCGC-3’) and reverse (5’-TAGACGTAGACCCCCAGAGTC-3’) primers using the GoTaq DNA polymerase (Promega) and analysed on a 1.5% agarose gel for analysis.
-
Spatial 3D genome organization controls the activity of bivalent chromatin during human neurogenesisbioRxiv - Neuroscience 2024Quote: ... Sorted nuclei were collected in 5-ml tubes containing 300-500 μl of collection buffer (PBS + 5% BSA) and RNasin Plus RNase inhibitor (Promega). Sorted nuclei were collected by centrifuging at 500g for 10 min at 4°C and processed for downstream analyses (RNA-seq ...
-
bioRxiv - Physiology 2024Quote: ... The locus containing the rdu14 allele was amplified by PCR, using the following primers (Forward: 5’-TGATTCACACTACTTACTTGTCTAG-3’, Reverse: 5’-GATTAAAAGTAGTTATCTCATCCTCAG-3’) and GoTaq polymerase (Promega, ). The genotype of the locus was scored after resolving samples on 2.5% agarose gels as HNF4α+/+ ...
-
bioRxiv - Immunology 2021Quote: ... in a mixture with 20 μl OptiMEM and 1μl FuGENE HD or FuGENE 6 (Promega E2691) per well ...
-
bioRxiv - Molecular Biology 2020Quote: ... Proteins were digested with Lys-C (Wako Chemicals) for 6 hours and trypsin (Trypsin Gold, Promega) overnight.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were cultured in DMEM+10% FBS+Penicillin/Streptomycin and transfected using FuGENE 6 (Promega). Co-recruitment assays were performed 24 hours after transfection ...
-
bioRxiv - Immunology 2020Quote: All VLPs were produced by transient transfection of HEK293T cells with Fugene 6 (Promega, ref E2691). HEK293T were seeded in 15-cm dishes to reach 60-70% confluency the next day and VLPs were produced by co-transfecting plasmids encoding Gag-eGFP and the VSV-G envelope (pGag-EGFP and pCMV-VSV-G ...
-
Safety and efficacy of C9ORF72-repeat RNA nuclear export inhibition in amyotrophic lateral sclerosisbioRxiv - Systems Biology 2021Quote: Three wells of a 6-well plate were lysed were lysed in Reporter lysis buffer (Promega) for 10 min on ice before centrifugation at 17,000 g ...
-
bioRxiv - Microbiology 2021Quote: All virus stocks were produced by plasmid transfection of HEK 293T cells with Fugene 6 (Promega). Supernatants were harvested at 48h and 72h ...
-
bioRxiv - Cell Biology 2022Quote: ... and pCMV-hyPBase was performed using 500 ng each DNA and 6 μl of FugeneHD (Promega) as per manufacturer’s instructions20,49,50 ...
-
bioRxiv - Biochemistry 2022Quote: ... Sf21 insect cells were transfected with PLP/DM20 bacmid using Fugene 6 transfection reagent (Promega Corp.) and baculoviruses were collected and used for preparation of a high-titer virus stock ...
-
bioRxiv - Microbiology 2020Quote: Plasmid DNA was combined at a 3:1 ratio of FuGENE® 6 Transfection Reagent (Promega) to DNA and incubated 20 min at RT ...
-
bioRxiv - Molecular Biology 2022Quote: Lentivirus particles were collected from HEK293T cell supernatant 3 days after co-transfection (FuGENE 6, Promega) of lentiviral plasmid constructs (Supplementary Table 2A ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... To transform the bacmid into Sf9 cells the transfection reagent FuGene 6 (Promega Corporation, Madison, USA) was used according to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2021Quote: ... HEK 293T cells were transfected with the pseudovirus encoding plasmids using FuGENE 6 Transfection Reagent (Promega). The virus culture supernatant was harvested at 48h and 72h post transfection and stored at -80°C until use ...
-
bioRxiv - Cancer Biology 2022Quote: ... The cell viability was assessed at day 6 post inhibitor treatment using CellTiter Glo 3D (Promega) according to manufacturer’s instruction.
-
bioRxiv - Cell Biology 2022Quote: Lipofectamine 3000 or FuGENE 6 transfection reagents (ThermoFisher Scientific/Invitrogen, cat# L3000008; and Promega, cat# E2691) were used for transient delivery of PRR14 plasmids ...
-
bioRxiv - Genetics 2023Quote: ... Transient expression of NSD2 VUS in HeLa cells was performed using FuGENE 6 (Promega, WI, USA). pCMV-3xFLAG-NSD2 and pCMV-3xFLAG-NSD2 c.2714C>T plasmids were constructed by VectorBuilder (IL ...
-
bioRxiv - Biophysics 2023Quote: We stably transfected U2OS cells with this plasmid using Fugene 6 following the manufacturer’s instruction (Promega). α-Amanitin (SIGMA #A2263 ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1.5μg of plasmid was transfected into 6-well dishes using Fugene HD (Promega, Madison, WI, USA) with 3:1 transfection reagent to DNA for 24 hours ...