Labshake search
Citations for Promega :
501 - 550 of 706 citations for 5 Alpha dihydroprogesterone since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... and alkylated with 5 mM of iodoacetamide 30 min in the dark at RT°C prior to digestion with 5 μg of trypsin Gold (Promega) for 15 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were pelleted (2000 g x 5 min) and subjected to genomic DNA (gDNA) extraction using the Wizard Genomic DNA Purification kit (Promega), according to the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2022Quote: ... 100 μL of Nano-Glo HiBiT Lytic Detection Reagent was added directly to the cells and incubated for 5 min on an orbital shaker (300 rpm) before recording luminescence on a GloMax Discover (Promega) with 0.2 s integration time.
-
bioRxiv - Immunology 2023Quote: ... samples were diluted 1:1 with water and digested for 1.5 hours at 37 °C with 1 µg of LysC and overnight at 37 °C with 1 µg trypsin (Promega). The peptide mixture was acidified with trifluoroacetic acid (Merck ...
-
bioRxiv - Neuroscience 2023Quote: ... We performed targeted PCR by adding 1 μL of cell lysate (1:5 dilution) to a 25-μL PCR reaction containing GoTaq Hot Start Master Mix Green (Promega) and 0.5 μL of the primers (10 µM ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were maintained at 37 °C and 5% CO2.Cell lines were authenticated using Short Tandem Repeat fingerprinting carried out using the GenePrint 10 system (Promega). For 3D spheroids ...
-
bioRxiv - Microbiology 2023Quote: ... and genomic DNA was isolated from overnight cultures (5 mL) using the Wizard Genomic DNA Purification Kit (Promega GmbH, Walldorf) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... a pPolI-Firefly plasmid encoding the Firefly luciferase sequence in negative polarity flanked by the 5’ and 3’ non-coding regions of the IAV NS segment was used and the pTK-Renilla plasmid (Promega) was used as an internal control ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... was co-transfected at a 1:5 ratio with either the HaloTag-ubiquitin plasmid (expressing Ub-Halo) or the HaloTag control (Promega). Transfected cells were incubated for 20 h at 37 °C ...
-
bioRxiv - Microbiology 2023Quote: The RNase III.RNA complexes were washed and the 5′ ends of bound RNAs were dephosphorylated with the addition of thermosensitive alkaline phosphatase (Promega). RNA was radiolabelled by phosphorylation with T4 PNK (Sigma-aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... 56 °C for 30 seconds and 72 °C for 30 seconds (30 cycles) and 72 °C for 5 minutes using GoTaq DNA polymerase (Promega) and a forward primer (hChimera exon 1-F ...
-
bioRxiv - Microbiology 2023Quote: ... were made by replacing the ORF3 region encoding 5–105 amino acids with an in-frame insertion downstream of 4th VP2 codon sequence of UnaG and NanoLuc (Promega) coding regions with their own stop codons ...
-
bioRxiv - Neuroscience 2023Quote: Surface expression was measured using a HiBit-tagged 5-HT2A receptor and the Nano-Glo HiBit Extracellular Detection System (Promega). N-terminal HiBit-tagged human 5-HT2A receptor was cloned into pcDNA3.1 using Gibson Assembly ...
-
bioRxiv - Biophysics 2023Quote: ... Samples were diluted 5-fold with 25 mM Tris pH 8.0 and 1 mM CaCl2 prior to digesting them with trypsin (Promega, V511X) at a 1:30 enzyme-to-protein ratio at 37 °C in a dry bath for 16 h.
-
bioRxiv - Developmental Biology 2023Quote: ... The following day membranes were washed 3 times n TBTS for 5 minutes and incubated in secondary antibody (1:2500 anti-Rabbit HRP conjugated, Promega) diluted in blocking buffer for 1 hour at room temperature and washed 3 times with TBTS for 5 minutes at room temperature ...
-
bioRxiv - Microbiology 2023Quote: ... 5% CO2 before measurement of Renilla and Firefly luciferase activities using Dual-Glo® Luciferase Assay System (Promega, Cat #E2920) and Tecan SPARK plate reader ...
-
bioRxiv - Plant Biology 2022Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested overnight (18 hours) with a Trypsin+LysC mixture (Promega) at a protein to protease ratio of 25:1 ...
-
bioRxiv - Biochemistry 2022Quote: ... with 10 ng pGL4.32[luc2P/NF-κB-RE/Hygro] (NF-κB response element-dependent firefly luciferase) or pGL4 [luc2P/AP-1-RE/Hygro] and 5 ng pRL-TK using the Dual Luciferase Reporter Assay (Promega). 24 hours post transfection ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2024Quote: ... To quantify the activity of reports groups of 5 embryos were collected 8 hours post-injection in triplicates and lysed in 100 mL of lysis buffer (Promega). Reporter expression was quantified with the Nano-Glo Dual-Luciferase Reporter Assay System (Promega ...
-
bioRxiv - Cancer Biology 2024Quote: ... Cells were treated 24h after seeding and cell viability was assessed 5 days after treatment using the Cell Titer-Glo luminescent cell viability assay (Promega). Cells treated with vehicle control DMSO (0.1% ...
-
bioRxiv - Microbiology 2023Quote: ... The inoculum was added to HEK293T cells and incubated at 37 ° C with 5% CO2 and the luciferase signal was with analyzed using luciferase assay kit (Promega).
-
bioRxiv - Biophysics 2024Quote: ... was incorporated at the 5’ end of the FL open reading frame during PCR amplification from a pRL-CMV vector (Promega). A Kozak consensus sequence and a 50-nucleotide upstream region was incorporated before the translation start site to ensure enough space for the assembly of translation initiation complex77 ...
-
bioRxiv - Neuroscience 2024Quote: ... The Renilla luciferase activity associated with WT or uORF-mutated 5’UTRs was measured according to the manual of the Dual-Luciferase Reporter Assay System (Promega) 32 h after transfection and was normalized to the activity of firefly luciferase.
-
bioRxiv - Molecular Biology 2024Quote: About 5 μg empty pcDNA3 vector or ZNF410 full-length and ZNF410-ZF plasmids was transiently transfected with FuGENE 6 (Promega) into 10 cm plates of COS-7 cells ...
-
bioRxiv - Molecular Biology 2024Quote: ... 40 µL of digestion solution (1.25 mM TCEP, 5 mM chloroacetamide, 0.2 µg trypsin/Lys-C mix (Promega, cat#V5073), in 100 mM HEPES pH 8.5 ...
-
bioRxiv - Molecular Biology 2024Quote: ... and then a final solution comprised of 17% formamide + 5% Triethalomine + 70% glycerol + 3% Tris (w/v, Tris, Promega, H5135) made in basic DDH20 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The final 50 µL translation reaction included the 5 µL RNA mixture described above and components from the Rabbit Reticulocyte Lysate system (Promega): 35 µL of rabbit reticulocyte lysate ...
-
bioRxiv - Microbiology 2023Quote: ... The viability of Vero cells treated with 5-FU and EIDD-1931 alone were assessed using CellTiter-Glo Viability Assay (Promega).
-
bioRxiv - Plant Biology 2023Quote: ... PCR reactions were conducted in 10 μL volume comprising 5 μL Promega 2x PCR Master Mix (Promega, Madison, Wisconsin, USA), 10 pmol of forward and reverse primers ...
-
bioRxiv - Biochemistry 2023Quote: ... The first-strand cDNA was synthesized from 5 µg of the total RNA with an oligo (dT) primer using the AMV reverse transcriptase (Promega). A polymerase chain reaction (PCR ...
-
bioRxiv - Immunology 2022Quote: ... that introduced a 5’ KpnI site and a 3’ XhoI site and cloned into the pGL3 firefly luciferase vector (Promega). Site directed mutagenesis was performed as described above ...
-
bioRxiv - Microbiology 2022Quote: ... Huh7.5.1 cells were infected with MLB1 and MLB2 astroviruses (MOI 5) in the presence or absence of 20 µM z-VAD-fmk (pan-caspase inhibitor, Promega). At indicated time post infection ...
-
bioRxiv - Developmental Biology 2022Quote: ... Proteins were on-bead digested using 5 μl of Sequencing Grade Trypsin (100 ng/μl in 10 mM HCl, Promega). The digestion was carried out in a microwave instrument (Discover System ...
-
bioRxiv - Molecular Biology 2022Quote: ... from the EPO gene enhancer (sequence: tcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgttcgaagccctacgtgctgtctcacacagccttct gatctcgacctaccggccgttcgaagccctacgtgctgtctcacacagcctgtctgacctctcgacctaccggccgt) into the 5’ of the minimal TATA-box promoter in the pGL4.23 [luc2/minP] vector (Promega #E841A). A control pHRL-TK vector (Promega #E2241 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Flies were placed individually in 100 ul Chelex solution (5g of Chelex mixed with 95ml TE buffer) with 5 ul proteinase K (Promega), and incubated overnight at 56°C ...
-
bioRxiv - Biochemistry 2022Quote: ... 1.7 μg of attB-hACE2-mNG2-1-10 plasmid or attB-S-mNG2-11 plasmid were added into 5 μL FuGENE 6 transfection reagent (Promega) and OptiMEM (Gibco ...
-
bioRxiv - Immunology 2022Quote: ... or HT1080/Ace2 cl14 cells (for all variant neutralization assays) for 48 hours after which cells were washed with PBS and lysedwith Luciferase Cell Culture Lysis 5× reagent (Promega). Nanoluc Luciferase activity in lysateswas measured using the Nano-Glo Luciferase Assay System (Promega ...
-
bioRxiv - Plant Biology 2022Quote: The dual luciferase assay (Figure 1 – figure supplement 5) was based on the Dual- Luciferase® reporter assay system (Promega). N ...
-
bioRxiv - Plant Biology 2022Quote: ... primer extension products reverse-transcribed with a gene-specific primer (reverse-complementary to the 16S rRNA nucleotides 1092-1108; 5’-CAGTCTGTTCAGGGTTC-3’) and AMV reverse transcriptase (Promega) were analyzed by qPCR with the primer pairs ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: Kinase activity of phosphorylated CDK2 with cyclin A and varying amounts of inhibitor (dinaciclib or 5) were measured using the ADP-Glo Kinase Assay (Promega) in a luminescence plate reader (Tecan Infinite M1000 PRO) ...
-
bioRxiv - Neuroscience 2022Quote: ... Flag-tagged STAU1 or STAU1RBDΔ3 or Flag plasmids with the wildtype or mutant 5’UTR-MTOR-LUC or luciferase empty vector constructs and Renilla luciferase plasmid (pRL-SV40 vector, Promega) according to an experimental set-up ...
-
bioRxiv - Biochemistry 2023Quote: ... dehydrated with 0.2 mL of 100% acetonitrile and rehydrated with 5 μL of the digestion solution containing 15 μg/mL sequencing-grade trypsin (Promega) in 20 mM aqueous solution of NH4HCO3 ...
-
bioRxiv - Cell Biology 2023Quote: ... supplemented with or without 50 μM adenosine 5′-triphosphate (ATP) at 30 °C for 30 minutes followed by kinase assays using ADP-Glo Kinase Assay kit (Promega). Data were analyzed using GraphPad Prism 9 ...
-
bioRxiv - Cell Biology 2022Quote: ... 5×104 cells/well were seeded in 24-well plates and transfected with 10 ng pRL-CMV (Promega, Walldorf, Germany) together with either 250 ng pSuper8xTOPFlash or 250 ng pSuper8xFOPFlash [22] using the FuGENE6® reagent (Promega) ...
-
bioRxiv - Cell Biology 2023Quote: ... 100 mM KCl, 5 mM MgCl2, 2 mM DTT, 100 μg ml-1 cycloheximide, and 20 U ml-1 RNase inhibitor [Promega].) Gradients were centrifuged 36,000 rpm for 2.5 h in a SW41 Ti rotor (Beckman Coulter ...
-
Disruption of the Aspergillus fumigatus RNA interference machinery alters the conidial transcriptomebioRxiv - Microbiology 2023Quote: ... Protein precipitates were resolubilized in 5% trifluoroethanol of aqueous 100 mM TEAB and digested for 18 h with Trypsin+LysC (Promega) at a ratio of 25:1 protein:protease ...
-
bioRxiv - Microbiology 2022Quote: ... cells were co-transfected with RIG-I-2CARD (5 ng) and lysed at 24 hours after transfection using Passive Lysis Buffer (Promega). Samples were processed and luciferase activity was measured using the Dual-Luciferase Assay System (Promega ...
-
bioRxiv - Neuroscience 2023Quote: ... UDP (at concentrations ranging from 1 nM to 1 mM) was then applied with a final concentration of 5 μM furimazine (NanoLuc Luciferase Assay, Promega). Luminescence was subsequently measured using a Victor X5 multi-label plate reader (PerkinElmer).
-
bioRxiv - Cell Biology 2024Quote: ... Oligonucleotides encoding guide RNAs targeting M18BP1 (5’- TTGTACTGAAAAAATCATCA-3’) were cloned into pX459-v2 and co-transfected using FuGENE 6 (Promega) with pUC19 containing a 1528 base pair stretch containing the mutated sequence of the locus of interest and homology arms ...