Labshake search
Citations for Promega :
5051 - 5100 of 6175 citations for Mouse Caprin 1 CAPRIN1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Physiology 2019Quote: ... The wounded area and its surrounding area (2 x 2 cm) were immediately dissected out and RNA extraction was conducted using Maxwell® RSC simplyRNA Tissue Kit (AS1340, Promega, Madison WI) following the manufacturer’s protocol ...
-
bioRxiv - Physiology 2019Quote: ... To ensure RNA was free of DNA contamination samples were DNase treated using an RQ1 RNase-free DNase kit (Promega Corporations, Madison, USA).
-
bioRxiv - Evolutionary Biology 2021Quote: ... We extracted genomic DNA from 400 µL of these cultures with the Maxwell® RSC Cultured Cells DNA Kits using a Maxwell® RSC Instrument (Promega, Switzerland), at the Functional Genomics Centre Zurich (FGCZ) ...
-
bioRxiv - Biochemistry 2021Quote: ... Amplified PCR products were visualized by blue light illumination and the 504/505 bp bands were excised and the amplified PCR product purified using the Wizard SV Gel and PCR Clean-Up kit (Promega, Madison, WI, USA). Extracted DNA was Sanger sequenced at the University of Michigan Advanced Genomics Core and analyzed for presence of the single base pair deletion using DNAStar LaserGene SeqMan Pro 15 ...
-
bioRxiv - Biochemistry 2021Quote: The kinase activity of the FLT3-ITD protein was measured by using ADP-Glo™ Kinase Assay Kit (Promega, Madison, Wisconsin, the US). Briefly ...
-
bioRxiv - Cancer Biology 2021Quote: Genomic DNA was extracted from FFPE tumor tissue samples of 18 patients within the cohort using the automated Maxwell system with the Maxwell 16 FFPE Plus LEV DNA Purification Kit (Promega, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: RNA was extracted from FFPE tissue samples using the automated Maxwell system with the Maxwell 16 LEV RNA FFPE Kit (Promega, Madison, WI, USA), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... All RACE-PCR products were purified using GeneJET Gel Purification Kit (Fermentas, Hanover, MD, USA) and ligated into pGEM-T vector (Promega, Madison, WI, USA) and transformed into competent JM-109 Escherichia coli cells (Promega ...
-
bioRxiv - Microbiology 2020Quote: ... Single-cell clones were obtained and the genomic DNA was then isolated using a Wizard SV genomic DNA purification kit (Promega, Madison, WI, USA). The target gene was amplified by PCR using pMXs vector forward (5’GGTGGACCATCCTCTAGA3’ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 24 hours later cells were harvested into 125 μl reporter lysis buffer and luciferase activity and β-galactosidase levels measured using a luciferase assay kit (Promega, Madison, WI) and a luminometric β-galactosidase detection kit (Takara Bio ...
-
bioRxiv - Cancer Biology 2020Quote: ... service by analyzing DNA samples from each individual cell line for polymorphic short tandem repeat (STR) markers using the GenePrint 10 kit from Promega (Madison, WI, USA).
-
bioRxiv - Microbiology 2020Quote: Samples from the human subject were extracted with a DNA extraction protocol adapted from the Maxwell RSC Buccal Swab DNA kit (Catalogue number AS1640: Promega Corporation, Madison WI). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... The viral RNAs were extracted from the homogenized lung tissue samples (10% w/v) and nasal wash samples using the Maxwell® RSC Viral Total Nucleic Acid Purification Kit (Promega, Madison, WI). The whole genomes of SARS-CoV-2 used in this research were amplified using a modified ARTIC protocol with several primers replaced or added (57 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cells were harvested in the lysis buffer and the fluorescence value was measured by a dual luciferase assay kit (Promega, Madison, WI, USA).
-
bioRxiv - Cell Biology 2022Quote: ... PCR products were purified with the Nucleospin gel and PCR clean-up kit (Macherey Nagel) and transcribed in vitro using T7 RNA polymerase (RiboMAX system; Promega, Madison, WI, USA). RNA was purified from the sample using the Nucleospin RNA clean-up kit (Macherey Nagel) ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Total RNA was extracted from the antennae (50 individuals) of soldiers and workers using an SV Total RNA extraction kit (Promega, Madison, WI, USA). The amount of RNA and DNA in each sample was quantified using a Qubit fluorometer (Life Technology ...
-
bioRxiv - Synthetic Biology 2022Quote: ... The viability of Vero-E6-Luc2+ cells was assessed using either CellTiter-Glo™ Luminescent Cell Viability Assay Kit (Promega, Cat# PR-G7570) or One-Glo® assay (Promega ...
-
bioRxiv - Microbiology 2022Quote: ... genomic DNA extraction was performed using a lysozyme/mutanolysin-based cell lysis followed by purification using the Wizard Genomic DNA Purification Kit (Promega, Madison, WI, USA). Library preparation on extracted DNA was conducted using a Kapa kit (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: These recombinant plasmids were co-transfected with the components of Dharmacon™ Trans-Lentiviral packaging kit into HEK293FT cells using FuGENE® HD (Promega Corp.) according to manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: The DNA was extracted using the Promega PCR Cleaning Kit (Wizard® SV Gel and PCR Clean-Up System, Promega Cat.-No. A9285) as indicated in the manual ...
-
bioRxiv - Molecular Biology 2022Quote: ... the transfected cells plated in 96-well black plates were examined using a CellTiter-Blue Cell Viability Assay kit (Promega, Madison, WI, USA). Briefly ...
-
bioRxiv - Systems Biology 2022Quote: ... Resistance against ribociclib was detected by the alteration of the dose–response curve measured using CellTiterGlo Chemiluminescent Kit (Promega Corporation, Cat. No.: G7573).
-
bioRxiv - Plant Biology 2024Quote: ... RNA was isolated from frozen harvested materials using the SV Total RNA isolation kit with on-column DNA digestion (Promega, Madison, WI, USA). The purity of all RNA samples was confirmed using a NanoDrop2000 instrument (Thermo Scientific) ...
-
bioRxiv - Neuroscience 2024Quote: NAD and NADP levels were measured using the commercially available kits NAD/NADH-Glo Assay and NADP/NADPH-Glo Assay (Promega G9071, Promega G9081), respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... cell viability and cytotoxicity were measured with CellTiter-Glo Luminescent Cell Viability Assay with CellTox Green Cytotoxicity Assay (Promega kits G7570 and G8741).
-
bioRxiv - Microbiology 2022Quote: ... The relative light unit value of luciferase was determined using the PicaGene Luminescence Kit (TOYO B-Net Co., Ltd., Tokyo, Japan) and GloMax Navigator System G2000 (Promega Corporation, Madison, WI), according to the manufacturer’s protocol.
-
bioRxiv - Microbiology 2023Quote: ... DNA was purified from the samples using the Maxwell 16 Tissue LEV Total RNA purification Kit custom-adapted for DNA extraction (cat no. AS 1220, Promega, Madison, Wisconsin, USA) in a Maxwell 16 MDx instrument (Promega) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were extracted from 2% agarose gel and purified using the AxyPrep DNA Gel Extraction kit (Axygen Biosciences, Union City, CA, USA) according to the manufacturer’s instructions and quantified using Quantus™ Fluorometer (Promega, Madison, WI, USA). The Illumina MiSeq platform (Illumina Inc. ...
-
bioRxiv - Developmental Biology 2023Quote: ... DNAs were purified using the PureYield Midiprep kit and were linearized before in vitro synthesis of anti-sense RNA probes using T7 or Sp6 polymerase (Promega, #P2077 and #P108G), RNAse inhibitor and dig-labeled rNTPs (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... and transferred to 96-well black plate to be treated with LARII and Stop & Glo components according to protocol of the Dual-Luciferase® Reporter Assay Kit (Promega CN: E1910). Luminescence was measured using a microplate reader (TECAN infinite M200pro) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Authentication of cell lines was confirmed regularly by short tandem repeat (STR) profiling by using the GenePrint 10 kit (Promega, Madison, WI, USA) on an ABI 3730 DNA analyzer (Applied Biosystems ...
-
bioRxiv - Physiology 2023Quote: ... coronary effluent was collected for detection and quantification of lactate dehydrogenase (LDH) using the Promega luminescent LDH-Glo 105TM Cytotoxicity Assay kit following manufacturer protocol (Promega, Madison, WI, USA).
-
bioRxiv - Physiology 2023Quote: Glutathione content was measured under normoxic conditions and after exposure to 30 min and 6 h hypoxia using the GSH-Glo Assay Kit (Promega, Madison, WI, USA) according to manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: gDNA extraction from formalin-fixed paraffin-embedded (FFPE) tissue sections was carried out using Maxwell 16 FFPE plus LEV DNA purification kit (AS1720; Promega, Madison, WI, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... was reverse transcribed with a GoScriptTM Reverse Transcriptase cDNA reverse transcription kit according to the manufacturer’s instructions (Promega Corporation, an affiliate of Promega Biotecnologia do Brasil, Ltda). Primers were designed and synthesized by IDT-DNA (San Diego ...
-
bioRxiv - Microbiology 2023Quote: ... globosa gut isolates (KCTC 37188 and KCTC 37189) and skin isolates (KCTC 27541 and KCTC 27777) was extracted using the Wizard HMW DNA Extraction Kit (Promega, Madison, WI, USA), according to the manufacturer’s recommendations ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... senegalensis DNA was extracted from muscle tissues in thoraxes using Maxwell® 16 LEV Plant DNA Kit (Cat. No. AS1420, Promega, WI, USA). Details on extraction and library preparation protocols are provided in the Supporting Text 1.
-
bioRxiv - Microbiology 2024Quote: ... for intra-subcellular (i.e., vacuolar) conversion of glutamine (Gln) to glutamate (Glu) assay using Glutamine/Glutamate-Glo Assay kit (Promega, Madison, WI; Cat. # J8021) following kit’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... Luciferase activities were conducted 24 hours after transfection in the cells treated with or without the TEAD inhibitor CP1 using the dual-luciferase reporter kit (cat. E1910, Promega, Madison, WI, USA). Assays were conducted in triplicates and quantified using PerkinElmer EnVision plate reader ...
-
bioRxiv - Cell Biology 2024Quote: ... BP1425-500) at 37 °C and the plasmid was isolated from single colonies using the PureYield Plasmid Midiprep kit (Promega, Cat no. A2495), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... The amplified product was used as a template to synthesize dsRNA using a RiboMAX Large Scale System-T7 Kit (Promega, Madison, WI, USA). The dsRNA was then isolated and purified ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... we digested tissues using Proteinase K enzyme and used a Maxwell® Rapid Sample Concentrator Instrument with Maxwell® 16 Tissue DNA Purification Kit (Promega Corporation). We used 34 cycles polymerase chain reaction (PCR ...
-
bioRxiv - Biophysics 2020Quote: CosM6 cells were transfected with ∼1 µg of wild type or mutant constructs using FuGENE6 (Promega) and were patched within 1-2 days after transfection ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was synthesized from 1 μg of each RNA sample using Oligo(dT)15 Primer (Promega) and M-MLV Reverse Transcriptase (RNase H Minus ...
-
bioRxiv - Microbiology 2021Quote: ... 1 µL cDNA was used as template for 25 cycles of PCR using GoTaq polymerase (Promega) targeting the TMV replicase using forward primer 5’ CCGCGAATCTTATGTGGAAT 3’ and reverse primer 5’ TCCTCCAAGTGTTCCCAATC 3’ ...
-
bioRxiv - Microbiology 2021Quote: ... A 1:10 solution of sample homogenate to colentrazine was analyzed on a GloMax Explorer (Promega).
-
bioRxiv - Neuroscience 2022Quote: ... using 0.5 - 1 μg of cDNA and FuGene as per the manufacturer’s instructions (Promega, Madison, WI). Cells were fixed for immunocytochemistry 24 or 48 h after transfection ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1.33 μL 1 M Tris-HCL pH 8.5 and 7.8 μL 0.5 mg/mL trypsin (Promega) were added and proteins left to digest for 16 hours at 37°C ...
-
bioRxiv - Biochemistry 2020Quote: ... Samples were diluted with 875uL of 50mM Tris buffer along with Trypsin (1:100, Promega #V511C) for overnight digestion ...
-
bioRxiv - Synthetic Biology 2020Quote: ... 0 or 1 μg Sequencing Grade Modified Trypsin (0 or 10 μl; #V5111, Promega, WI, USA) that was reconstituted within trypsin re-suspension buffer (50 mM acetic acid ...