Labshake search
Citations for Promega :
451 - 500 of 5481 citations for Mouse Eukaryotic translation initiation factor 4E binding protein 3 EIF4EBP3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 3’UTR Wild and 3’UTR-Mutant were incorporated into XbaI restriction site of PGL3-control vector (Promega) expressing firefly luciferase ...
-
bioRxiv - Cancer Biology 2023Quote: ... Caspase 3/7 activities in were assessed by using Caspase-Glo 3/7 assay (Promega Corp., Madison, WI) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: Caspase-3/7 activity in leukemia cells were detected by Caspase-Glo 3/7 Assay System (G8091; Promega) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2022Quote: ... Proteins were purified by using MagneHis™ Protein Purification System (Promega, USA). The peptides of the transporters PDR6 ...
-
bioRxiv - Biophysics 2022Quote: ... Fusion protein was purified using HisLink Protein purification resin (Promega (Madison, WI) #V8821 ...
-
Neuronal L-Type Calcium Channel Signaling to the Nucleus Requires a Novel CaMKIIα-Shank3 InteractionbioRxiv - Neuroscience 2019Quote: ... Media was then removed and cells were incubated in serum-free DMEM containing either 0.49% dimethyl sulfoxide (Pierce) or a differentiation medium (serum-free DMEM supplemented with 10 ng/ml fibroblast growth factor (Promega), 240 μM isobutylmethylxanthine (Sigma) ...
-
bioRxiv - Cancer Biology 2019Quote: ... and Jurkat T cells overexpressing hPD-1 and carrying a luciferase reporter gene under the control of Nuclear Factor of Activated T-cells Response Element (NFAT-RE) (hPD-1 Effector Cells, hPD-1 ECs, Promega) were cultured in RPMI-1640 medium (Biowest ...
-
bioRxiv - Cancer Biology 2021Quote: ... For these experiments pGL2M4-luc reporter plasmid37 (containing four CACGTG binding sites, a canonical E-box) and pRL Renilla Luciferase Control Reporter Vectors (CMV, Promega E2231) were used ...
-
bioRxiv - Developmental Biology 2021Quote: A partial TWD1 fragment of 150 bp covering the TPR domain and a part of the calmodulin binding domains (aa 264-314) was PCR amplified and cloned into pGEM-T-Easy Vector (Promega Corp.) and verified by sequencing ...
-
bioRxiv - Cell Biology 2021Quote: ... or without (150 bp) one putative ETV2 binding site (Wei et al, 2010) were cloned into pGL3_Basic vector (Cat# E1751, Promega, Madison, WI). Primers Forward ...
-
bioRxiv - Molecular Biology 2019Quote: The 3’ UTR of target mRNAs spanning at least 500 bp around the predicted miRNA binding sites were cloned into the psi-CHECK2 vector (Promega, C8021) downstream of the Renilla luciferase gene (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: FOXM1 3’UTR region comprising of miRNA binding region was cloned into pmirGLO-Dual Luciferase miRNA target expression vector for miRNA luciferase reporter assay (Promega, USA) in MCF-7 cell lines ...
-
bioRxiv - Genomics 2023Quote: The IRF3/IRF7 luciferase reporter was constructed by subcloning 3x IRF3/7 binding element (GTCAGGAGAAGGAAACCTTC) into the Sal I and HindIII sites in the pGL3-basic (Promega E1751) backbone vector ...
-
bioRxiv - Genomics 2021Quote: ... Tris(2-carboxyethyl)phosphine (TCEP) and BCA protein assay kit were from Pierce and sequence-grade trypsin was from Promega. Rapigest and Sep-Pak C18 columns were from Waters and C18 Zip tips were from Millipore ...
-
bioRxiv - Plant Biology 2023Quote: ... Transcription factors were expressed using at least 2000 ng PCR product per sample with the TnT T7 Quick for PCR DNA in vitro protein expression kit (Promega). All reaction volumes were doubled to yield a total of 100 µL protein product per transcription factor ...
-
bioRxiv - Cell Biology 2024Quote: 35S-methionine-labelled prey proteins (Grip91, Sas4) were produced in vitro using the TnT T7 Quick Coupled IVTT kit (L1170, Promega). The detailed protocol of the GST-IVTT binding assay is described previously 52.
-
bioRxiv - Cancer Biology 2021Quote: ... and Caspase 3/7 Glo (Promega #G8091) were added and assayed according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... 3 μL of Cell Titer Glo (Promega) were added to each well ...
-
Targeted degradation of PCNA outperforms stoichiometric inhibition to result in programed cell deathbioRxiv - Cell Biology 2022Quote: ... For the Caspase 3/7 Glo (Promega) assay ...
-
bioRxiv - Biochemistry 2020Quote: ... and Caspase-Glo 3/7 assay (Promega), respectively ...
-
bioRxiv - Zoology 2021Quote: ... and 3% 20mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact.
-
bioRxiv - Cell Biology 2022Quote: ... We added 3 μg Trypsin Gold (Promega) to each sample for digestion and incubated samples at 37°C overnight (approximately 16 hours ...
-
bioRxiv - Microbiology 2022Quote: ... 3 μL of dNTPs (20mM, Promega®), 5 μL of buffer (5x ...
-
bioRxiv - Microbiology 2022Quote: ... 3 μL of dNTPs (20mM, Promega®), 5 μL of buffer (5x ...
-
bioRxiv - Cancer Biology 2022Quote: ... The Caspase-Glo 3/7 Assay (Promega) was performed according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2019Quote: ... Caspase-Glo 3/7 assays (Promega, G8090) were performed as per the manufacturer’s instructions ...
-
bioRxiv - Zoology 2020Quote: ... and 3% 20mg/ml Proteinase K (Promega). Many additional photos of spicules and sections are available in the supplementary data that accompanies this paper ...
-
bioRxiv - Genetics 2020Quote: ... 3 μl of RNasin ribonuclease inhibitor (Promega) per ml of extraction buffer] ...
-
bioRxiv - Molecular Biology 2022Quote: ... For SUMO1-3 thrombin (16 U; Promega) was used for cleavage in buffer (20 mM Tris-HCl pH 8.4 ...
-
bioRxiv - Zoology 2022Quote: ... and 3% 20mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Cancer Biology 2023Quote: ... by Caspase-Glo 3/7 assay (Promega), were assessed using manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Caspase-Glo® 3/7 reagent (Promega) was added to each well as per manufacturer’s instruction ...
-
bioRxiv - Zoology 2024Quote: ... and 3% 20mg/ml Proteinase K (Promega). This digestion eliminates cellular material while leaving the spongin network intact ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 ul of RNasin Ribonuclease Inhibitor (Promega) was added to the beads and incubated for 2 hours at 4°C/3rpm ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl MgCl 25 mM (Promega A3511), 0.2 mM dNTPs ...
-
bioRxiv - Cell Biology 2019Quote: ... ELISA data was normalized to viable cell number determined by MTT assay (Boehringer Ingelheim) or CellTiter-Blue (Promega). IFN levels were determined using a HEK293T IFN reporter cell line (clone 3C11 ...
-
bioRxiv - Physiology 2023Quote: ... GLP-1 was detected by indirect sandwich amide chemiluminescence ELISA using a luminescence plate reader (GloMax Promega, USA). This total GLP-1 assay detects GLP-1 (7-36 ...
-
bioRxiv - Molecular Biology 2021Quote: ... A protein standard (Promega) was added to the non-tagged cells as a known reference of protein concentration to luminescence output ...
-
bioRxiv - Microbiology 2022Quote: ... Protein Precipitation Solution (Promega) was added to the lysate ...
-
bioRxiv - Molecular Biology 2020Quote: ... HaloTag Standard Protein (Promega) was labelled with 10 fold molar excess (5 µM ...
-
bioRxiv - Genetics 2023Quote: ... Protein Precipitation Solution (Promega) was added to the lysed mixture ...
-
bioRxiv - Microbiology 2023Quote: ... Protein precipitation solution (Promega) was added and samples were vigorously mixed ...
-
bioRxiv - Cell Biology 2021Quote: ... genomic DNA from Proteinase K-digested mouse toes was extracted using the Wizard SV genomic DNA extraction kit (Promega, A2360). PCR reactions to amplify a fragment containing the target sites were carried out using the forward and reverse primers (Forward primer ...
-
bioRxiv - Cancer Biology 2022Quote: ... Mouse DNA was extracted from the ear using the Wizard® Genomic DNA Purification Kit from Promega (Madison, WI, USA), as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... 500 nM of each primer (5’-TCCTGCTCAACTTCCTGTCGAG-3’ and 5’-CACAGGTCAAACCTCCTAGGAATG-3’) and 0.1 µL hot-start Taq DNA polymerase (Promega) in 20 mM Tris−HCl pH 8.3 ...
-
bioRxiv - Cancer Biology 2022Quote: ... caspase-3 and caspase-7 activities were measured using a Caspase Glo 3/7 Assay (G8090; Promega, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... was determined at day 3 and 4 post-transfection using the Caspase-Glo 3/7 Assay (Promega, Mannheim, Germany). The emerging fluorescence was detected (485Ex/527Em ...
-
bioRxiv - Microbiology 2023Quote: ... 20 μL of MTS (3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium) inner salt (Promega) was added to each well and the plate was further incubated for 1 h at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 20 μL of [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium] (MTS) (Promega, #G3582) were added and incubated at 37°C for 3 hours ...
-
bioRxiv - Neuroscience 2023Quote: Protein-protein interaction was analyzed using the NanoBit Protein:Protein Interaction (PPI) System (Promega) according to the manufacturer’s instructions ...