Labshake search
Citations for Promega :
451 - 500 of 4490 citations for 6 Bromo 3 N ethylamino 1 2 4 triazolo 4 3 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... Membranes were washed 3 times for 10 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 5% non-fat dry milk -TBST for 1 h at RT ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ObLiGaRe-TLR construct was co-transfected with Zinc Finger Nuclease (ZFN)-AAVS1 plasmid in a 1:3 ratio using FuGENE transfection reagent (Promega) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... For transient expression experiments each well was transfected with 100 ng of DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Twenty-four hours after transfection or doxycycline stimulation ...
-
bioRxiv - Biophysics 2023Quote: ... Bacmids for the wild type and all Xl-HAS-1 mutants were purified from 3 white colonies and transfected into Sf9 cells at 1×106 cells/mL using the FuGene reagent (Promega). Cells were maintained in ESF921 medium (Expression Systems ...
-
bioRxiv - Cell Biology 2023Quote: ... Membranes were washed 3 times for 15 min in TBST and subsequently incubated with species-specific HRP-conjugated secondary antibodies (1:10000; Promega) in 3% BSA -TBST for 1h at room temp ...
-
bioRxiv - Bioengineering 2023Quote: ... Transfection was performed with 1 μg of plasmid DNA in combination with 3 μL of Fugene HD transfection reagent per well (Promega).
-
bioRxiv - Microbiology 2023Quote: For NanoBIT experiments 12,000 HeLa cells were seeded in 96-well black plates and each well was transfected with 100 ng of total DNA using 1:3 ratio of FUGENE HD (#E2311, Promega). Different amounts of plasmid DNA were used to achieve comparable expression of LgBiT/FLAG-tagged and SmBiT/V5-tagged proteins ...
-
bioRxiv - Microbiology 2024Quote: ... DTT was then added to a final concentration of 3 mM before adding 1 μg of sequencing-grade trypsin (Promega) and incubating at 37C overnight ...
-
bioRxiv - Biochemistry 2024Quote: ... ∼1/3 of the Coomassie-stained band was cleaved from the gel and samples were prepared with Trypsin Gold (Promega) in accordance with manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... and (5’ TATCCACCTTTACTGTCA TGTAGCAGTAGAGGACCTTCGCCGCTGC 3’) using human cDNA prepared from hTERT RPE-1 cells using GoScript Reverse Transcription System (Promega) following the manufacturer’s instruction ...
-
bioRxiv - Biochemistry 2022Quote: ... followed by the secondary antibody for 1 h at +4 °C (anti-rabbit IgG-HRP, Promega 65-6120). The Pierce® enhanced chemiluminescence substrate (Thermo-Fischer Scientific ...
-
bioRxiv - Biochemistry 2022Quote: ... the beads with bound recombinant proteins were blocked for 1 h at 4°C using reticulocyte lysate (Promega). Next ...
-
bioRxiv - Cancer Biology 2019Quote: ... ATP solution (5 μL of a 100 μM solution containing 0.1 μg 4:1 glycine:tyrosine peptide substrate (Promega)) was added and incubated at 37 °C for 20 min before the addition of ADP-Glo reagent (5μL ...
-
bioRxiv - Systems Biology 2023Quote: ... Samples were diluted 1:4 with 50 mM Tris/HCl (pH 8.0) and sequencing grade modified trypsin (Promega) was added in an enzyme-to-substrate ratio of 1:50 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Digests were carried out in 4M urea 100mM HEPES with LysC (Wako, #121-05063, 1/100 (w/w) protease/substrates) for 3 h at 37C and subsequent trypsin digest (Promega, #V5280, 1/100 (w/w) protease/substrates ...
-
bioRxiv - Microbiology 2019Quote: ... using FuGENE6 transfection reagent at a ratio of 3:1 (FuGENE6:DNA) according to manufacturer’s instructions (Promega, Madison, WI, Cat. #E2691). Twenty-four hours post-transfection ...
-
bioRxiv - Immunology 2021Quote: ... 2.5 μl TDE1 and 22 μl nuclease-free water were combined and placed at 37°C for 3 min before 0.5 μl of 1% Digitonin (Promega, Cat. #G9441) was added to the master mix ...
-
bioRxiv - Zoology 2021Quote: ... cDNA (DFV, NDV, AIV, DHV-1, DHV-3) were prepared with viral RNAs using M-MLV Reverse Transcriptase (Promega, Wisconsin, USA). Bacterial genomic DNA (R ...
-
bioRxiv - Microbiology 2020Quote: ... This was followed by a second round of TBST washes before incubation with HRP conjugated goat anti-mouse Ab (1:5000 Ab in 3 % BSA in TBST; Promega Corp.) for an hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... Protein was digested with Lys-C (Wako) (1:50 enzyme-to-substrate ratio) for 3 h at 25°C and with sequencing-grade modified trypsin (Promega, V5117) at 25°C for 14 h ...
-
bioRxiv - Immunology 2022Quote: ... Samples were diluted two-fold with 100 mM of triethylammonium bicarbonate (TEAB) and proteins were digested during 3 hours with 1 µg of trypsin (Promega V5111) and 1 µg of LysC (Wako 129-02541 ...
-
bioRxiv - Cell Biology 2020Quote: ... at a protein:Lys-C ratio of 100:1 (w/w) for 4 h at 37°C followed by trypsin (Promega) digestion at a ratio of 50:1 (w/w ...
-
bioRxiv - Cancer Biology 2022Quote: The 4T1-mScarlet and 67NR-GFP cell lines were generated by transfection using a 1:4 ratio of plasmid DNA:FugeneHD reagent (Promega), according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... Tryptic digests were performed overnight after addition of 46 μl of 100 mM Hepes pH 7.6 and 4 μl of 1 μg/μl Trypsin Gold (Promega).
-
bioRxiv - Cell Biology 2021Quote: ... at room temperature (r.t.) for 4 hours and then further digested overnight with 1:50 (w/w) trypsin (Promega) at r.t ...
-
bioRxiv - Biochemistry 2023Quote: ... 10 µL of 1:100 (diluted in phenyl red-free DMEM with 4% FBS) Nano-Glo substrate (Promega N1572) was added in each well ...
-
bioRxiv - Plant Biology 2023Quote: ... Two µl of cDNA (1:4 dilution) was added to a 20µl qPCR reaction using the GoTaq qPCR Master Mix (Promega) and ran on a BioRad CFX Opus96 thermocycler ...
-
bioRxiv - Immunology 2020Quote: Activity of the inflammatory caspases 1/4/5 was measured using a commercially available Caspase-Glo® 1 Inflammasome Assay (Promega, WI, USA) from HFFs seeded in 96-well plates (2×104 cells per well) ...
-
bioRxiv - Microbiology 2020Quote: ... Assays were harvested on day 3 using BrightGlo luciferase reagent (Promega, Madison, WI) and luminescence detected with a Victor luminometer (PerkinElmer ...
-
bioRxiv - Pathology 2019Quote: ... RNA (3 μg) was retro-transcripted by using M-MLV (Promega, Madison, WI). qPCR was performed in triplicate by using validated qPCR primers (BLAST) ...
-
bioRxiv - Cancer Biology 2020Quote: Cell death was analyzed using Caspase-Glo 3/7 Assay (Promega, Madison, WI), according to the manufacturer’s instructions.
-
bioRxiv - Microbiology 2021Quote: ... was measured using the Caspase-Glo-3/7 kit ((Promega, Madison, WI, USA). The luminescence assay was measured using Biotek Synergy H1 microplate reader (Biotek ...
-
bioRxiv - Biochemistry 2022Quote: ... ~2.5 μg recombinant bacmid DNA and 3 μl FuGENE HD Transfection reagent (Promega) in 100 μl Sf900 II media (Invitrogen ...
-
bioRxiv - Microbiology 2020Quote: ... Tissues were embedded in 3% low melting point agar (Promega, Madison, WI, USA). Formalin embedding ...
-
bioRxiv - Neuroscience 2019Quote: ... caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega). Cell viability was detected using the CytoPainter Live Cell Labeling Kit (Abcam ...
-
bioRxiv - Biochemistry 2020Quote: ... the Caspase-Glo 3/7 reagent (G8092/G8093 kit; Promega, Madison WI, USA) was prepared at room-temperature according to the manufacturer′s specifications ...
-
bioRxiv - Cell Biology 2020Quote: ... Cells were transfected with 3 μg of DNA using FuGENE HD (Promega; E2311). Cells
-
bioRxiv - Biochemistry 2022Quote: ... Apoptosis was measured using the Caspase-Glo® 3/7 assay system (Promega). Cells were seeded at a density of 1 × 104 in 96-well black polystyrene microplates (Corning) ...
-
bioRxiv - Cell Biology 2022Quote: ... Apoptosis was measured with the caspase-Glo 3/7 assay (Promega Cat# G8092), following manufacturer recommendations.
-
bioRxiv - Cancer Biology 2022Quote: ... Cells were tested for mycoplasma every 3 months with the Mycoalert kit (Promega), and identity was confirmed by STR profiling (DFCI molecular diagnostics laboratory) ...
-
bioRxiv - Molecular Biology 2022Quote: Active caspases were detected using the Caspase-Glo 3/7 Assay System (Promega). The experiment was set up using the same protocol as proliferation assay ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... and incubated at 37 °C for 3 h with Trypsin/Lys-C (Promega) at a 25:1 protein:protease ratio (w/w) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... plates were dispensed with 3 µL of CellTiter-Glo® (Promega, Madison, WI), centrifuged for 15 seconds at 1,000 RPM’s ...
-
bioRxiv - Neuroscience 2023Quote: ... Caspase activity was quantified using the Caspase-Glo 3/7 Assay Kit (Promega).
-
bioRxiv - Molecular Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Flo (Promega) or CaspaseGlo (Promega ...
-
bioRxiv - Cell Biology 2023Quote: ... and pMRXIH together with 3×FLAG tag or HaloTag7 (N2701, Promega, Madison, WI). DNA fragments encoding ATG2A (NM_015104.3 ...
-
bioRxiv - Cancer Biology 2023Quote: ... and plates were incubated for 3 days after which CellTiterGlo (Promega, Madison, WI) was added according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cell viability and caspase 3/7 activity was measured with CellTiter Glo (Promega) or Caspase Glo (Promega ...
-
bioRxiv - Biochemistry 2023Quote: ... RNA (3 μg) was retro-transcribed by using M-MLV (Promega, Madison, WI). qPCR was performed in triplicate by using validated qPCR primers (BLAST) ...
-
bioRxiv - Bioengineering 2023Quote: ... the Caspase-Glo 3/7® or Caspase-Glo 8® assay (Promega) was performed according to the manufacturer’s protocol ...