Labshake search
Citations for Promega :
701 - 750 of 4490 citations for 6 Bromo 3 N ethylamino 1 2 4 triazolo 4 3 a pyridine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... N-glycans were enzymatic released using 3.5 U Flavobacterium meningosepticum N-glycosidase F (Promega) in 20µl water/well ...
-
bioRxiv - Microbiology 2020Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously26 ...
-
bioRxiv - Immunology 2022Quote: ... In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The plasmid for β-arrestin-2 fused at the N-terminus to LgBiT was obtained from Promega (plasmid no. CS1603B118). Construction of the GLP-1R-SmBiT plasmid was described previously (55 ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... The plasmid for β-arrestin-2 fused at the N-terminus to LgBiT was obtained from Promega (plasmid no. CS1603B118); this configuration was used due to previous success with another class B GPCR (Shintani et al. ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously [25] ...
-
bioRxiv - Microbiology 2022Quote: In vitro transcription was performed for EagI-cleaved YACs and PCR-amplified SARS-CoV-2 N gene using the T7 RiboMAX Large Scale RNA production system (Promega) as described previously20 ...
-
bioRxiv - Biochemistry 2021Quote: ... 2 U μL-1 RNasin (Promega), 1 mM ATP/GTP/CTP ...
-
bioRxiv - Molecular Biology 2022Quote: ... pNLF1-N [CMV Hygro] (Promega), and pNLF1-C [CMV Hygro] (Promega ...
-
bioRxiv - Cell Biology 2021Quote: ... Briefly 70-90% confluent cells in 6-well plated were transfected with 1 µg CRISPR/Cas9 plasmids per well by using FuGENE 6 (Promega, Madison, Wisconsin). After 24 h post-transfection ...
-
bioRxiv - Cancer Biology 2021Quote: ... Caspase 3/7 activity was measured on a Molecular Devices microplate reader using Caspase Glo reagent from Promega per the manufactures protocol and normalized to cell number.
-
bioRxiv - Bioengineering 2022Quote: ... 3 mM CaCl2 at pH 6.4) 0.2 µg/μL protein was mixed with proteases trypsin (Promega sequencing grade), chymotrypsin (BD) ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer at ...
-
bioRxiv - Microbiology 2020Quote: ... dengue protein NS2B/3/4A constructs were expressed in rabbit reticulocyte lysate (TNT coupled T7, Promega Bio Systems) programmed with 1 µg DNA/50 µL and labeled with 20 µCi of L-[35S]-methionine (EasyTag ...
-
bioRxiv - Cancer Biology 2020Quote: ... the full length 3′UTR and dUTR sequences described above were cloned into a SmaI-digested psiCHECK2 (Promega) vector via blunt-end cloning.
-
bioRxiv - Molecular Biology 2019Quote: Full length 3’-UTR of human (P)RR and LDLR were cloned into the luciferase reporter vector (Promega). Mutant 3’-UTR luciferase reporter vectors were generated by PCR using site-directed mutagenesis technique ...
-
bioRxiv - Neuroscience 2020Quote: ... was incubated for 20 min with a mixture of 57 µL OptiMEM and 3 µL FuGene6 (Promega E2692). After FuGene6/DNA complex formation ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Apoptosis was determined for the same paclitaxel treatments using the Caspase-Glo 3/7 assay (Promega, Madison, WI). Luminescence was measured on a Synergy 2 microplate reader (BioTek ...
-
bioRxiv - Molecular Biology 2022Quote: Reporter constructs were generated by inserting artificial 3’UTRs downstream of Renilla luciferase of the psiCHECK2 vector (Promega). Briefly synthetic sequences containing three perfect binding sites (TACCTGCACTATAAGCACTTTA ...
-
bioRxiv - Neuroscience 2023Quote: Caspase activation was measured by luminescent assays (Caspase-Glo-3/7, -8 or -9, Promega, Madison, WI, USA), in cells treated for 8h with 50uM Aβ40-E22Q ...
-
bioRxiv - Cell Biology 2024Quote: ... Caspase-Glo® 3/7 Assay was then performed according to the manufacturers’ protocol (Promega, Madison, Wi, USA) and 20 µM Ac-DEVD-CHO was added to select wells for each condition as a negative control ...
-
bioRxiv - Synthetic Biology 2022Quote: ... 2 μL BSA (1 mg/mL) and 2 μL buffer H (Promega) in reaction volume of 20 μL ...
-
bioRxiv - Microbiology 2020Quote: ... at a ratio of 2:2:1 using Fugene®HD (Promega). At 48 h post transfection ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... DNA was extracted individually from whole bees (test; n=300, control; n=165) by Promega Wizard® purification.
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Biochemistry 2020Quote: ... and cells were lysed at 4 hours post-transfection with 250 μL passive lysis buffer (Promega) and incubated 20 minutes at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: ... and NUMB1-4 (from V.O.R.) expression plasmids was performed using FuGENE HD transfection reagent (Promega, E2311) according to the manufacturer’s protocol and selected with Geneticin (Gibco ...
-
bioRxiv - Cancer Biology 2022Quote: ... Viability was measured every 4 days using the CellTiter-Glo luminescent cell viability assay (Promega G7573). A D300e drug dispenser (Tecan ...
-
bioRxiv - Plant Biology 2022Quote: ... and GST- GBF3 were purified from 4 ml culture and immobilized on MagneGST Glutathione particles (Promega). Briefly ...
-
bioRxiv - Microbiology 2023Quote: ... then digested with 4 μL of a trypsin/Lys-C Mix (0.5 μg/uL) (Promega # V5071) using a two-step in-solution digestion overnight at 37°C ...
-
bioRxiv - Biochemistry 2023Quote: ... HRP (4 μM) was added followed by 20 μL of Nano-glo luciferase substrate (Promega, N1110) to each well ...
-
bioRxiv - Cell Biology 2022Quote: FuGENE 6 (Promega) was used to transfect RPE1 cells with plasmids for generating CRISPR/Cas9 knockouts ...
-
bioRxiv - Cell Biology 2021Quote: ... FuGENE 6 (Promega) transfection reagent was used according to the manufacturer’s instructions to transfect HeLa cells at a 3:1 ratio (using 1.5 μL FuGENE 6 and 0.5 μg DNA per well) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Fugene 6 (Promega) was used to transfect 5 μg of vector into 100 mm plates of COS-7 cells ...
-
bioRxiv - Systems Biology 2021Quote: ... Fugene 6 (Promega) was used for transfection one day before imaging following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... FuGENE 6 (Promega) transfection reagent was used according to the manufacturer’s instructions to transfect at a 3:1 ratio (using 1.5 µL FuGENE 6 and 0.5 µg DNA per well) ...
-
bioRxiv - Cell Biology 2024Quote: ... FuGENE 6 (Promega) was used for all transfections according to the supplied protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Fugene 6 (Promega) or Fugene 4K (Promega ...
-
bioRxiv - Cell Biology 2020Quote: ... the artificially synthesized PlGF 3’ untranslated regions (UTR) gene fragment was constructed into pMIR-reporter (Promega, Madison, WI, USA). A complementary sequence with mutation of the seed sequence was designed based on the wild type (WT ...
-
bioRxiv - Molecular Biology 2020Quote: ... FLuc levels were measured 3-days post-AAV administration using a Luciferase 1000 Assay System kit (Promega Cat#E4550) per manufacturer’s instructions and read on a Veritas luminometer with settings ...
-
bioRxiv - Cell Biology 2019Quote: ... nuclei from HepG2 cells were isolated by incubating cell pellets in 500 μl of a hypotonic buffer for 15 min on ice (20 mM Tris-HCL, pH 7.4, 10 mM NaCl, 3 mM MgCL2, with protease and phosphatase inhibitor cocktail from Promega). Triton X-100 detergent was added to a 0.5% v:v final concentration to lyse the cells followed by centrifugation at 1200 × g for 10 min to pellet nuclei ...
-
bioRxiv - Cell Biology 2021Quote: ... fumigatus pyrGAf gene and 870 nucleotides of the myoE 3’-UTR region was cloned in pGEM-T easy (Promega). This plasmid was used as template for site-directed mutagenesis (QuickChange kit ...
-
bioRxiv - Molecular Biology 2020Quote: MC Stem-HalV and GUS-(HalV IGR) mRNAs (3 pmol) were translated in 20μl reaction volume of Flexi rabbit reticulocyte lysate (Promega) in the presence of [35S]methionine (>37.0 TBq/mmol ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were incubated at 37°C/5% CO2 for 3 days before performing CellTiter-Glo (CTG) assays as per the manufacturer’s instruction (Promega). Luminescence was read using a Molecular Devices Spectramax L plate reader ...
-
bioRxiv - Cancer Biology 2021Quote: ... wild-type and mutant MMP2 3′-UTRs were synthesized and recombined into pmirGLO Luciferase vectors (Promega, Madison, WI, USA). Then pmirGLO-Wt/pmirGLO-Mt or miR-1299 mimics/miR-NCs were co-transfected into EC9706/KYSE30 cells ...
-
bioRxiv - Genomics 2022Quote: ADGRG6_3 and ADGRG_4 sequences were PCR amplified from human genomic DNA and cloned into the pGL4.23 plasmid (Promega, E8411). Human preadipocytes ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... Cells were incubated at 37°C and 5% CO2 for 3days before CellTiter-Glo (CTG) assays were performed as per the manufacturer’s instructions (Promega). Luminescence was read using a Molecular Devices SpectraMax L plate reader.
-
bioRxiv - Molecular Biology 2019Quote: ... 200 µg lysate was mixed with 0.1 µl RNase A (~3 mg/ml) and increasing concentrations of RNasin (Promega), as indicated ...
-
bioRxiv - Pathology 2021Quote: ... Cytopathic effects of the virus were measured after 3 days using the CellTiter-Glo luminescent cell viability assay (Promega), according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2021Quote: ... The RIP fraction was washed with Washing Buffer (0.3 M NaCl; 20 mM Tris-HCl pH7.5; 5 mM MgCl2; 5 mM DTT; protease inhibitor tablet; RNasin PROMEGA) three times ...