Labshake search
Citations for BioLegend :
801 - 850 of 1188 citations for Phospho Tyrosine Rabbit Polyclonal Biotin labeled since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... Dead cells were labeled with Zombie Aqua™ Fixable Viability Kit (Cat# 423102 Biolegend, San Diego, CA). Gating strategy was followed ...
-
bioRxiv - Immunology 2023Quote: ... Enriched CD4+ T cells were stained with viability dye and labeled with anti-mouse CD16/32 (Biolegend). Samples were stained with TotalSeq-C anti-mouse hashtag antibodies (Biolegend) ...
-
bioRxiv - Immunology 2023Quote: ... For the negative enrichment we used the same antibodies as for the staining but PE-labeled (Biolegend, Cat ...
-
bioRxiv - Bioengineering 2024Quote: ... and 0.01% NaN3 (Sigma-Aldrich)] and labeled for 1 h on ice with an antibody lineage cocktail containing CD3-BV510 (UCHT1, Biolegend), CD14-BV421 (M5E2 ...
-
bioRxiv - Immunology 2024Quote: ... and PBMCs were stained with fluorescently labeled antibodies targeting CD123 (from BioLegend in San Diego, CA, USA), human lineage 1 markers (CD3 ...
-
bioRxiv - Cell Biology 2019Quote: ... Anti-NMIIB Rabbit (Biolegend #909901) primary antibody was diluted 1:1000 in 5% milk TBST and placed on membrane overnight in a rocker platform at 4 °C ...
-
bioRxiv - Immunology 2021Quote: ... + donkey α-rabbit BV421 (Biolegend).
-
bioRxiv - Cell Biology 2021Quote: ... rabbit anti-Pax6 (Biolegend, B214847), goat anti-phospho-Histone 3 (Santa Cruz ...
-
bioRxiv - Cell Biology 2022Quote: ... rabbit anti-PCNT (Biolegend 923701), mouse anti-PLK1 (Thermofisher 33-1700) ...
-
bioRxiv - Neuroscience 2020Quote: ... rabbit anti Pax6 (Biolegend 901301), Sheep anti TBR2/EOMES (R&D system AF6166) ...
-
bioRxiv - Cell Biology 2022Quote: ... Rabbit anti-Loricrin (905101, Biolegend) 1:1000 ...
-
bioRxiv - Cell Biology 2020Quote: ... Rabbit anti-Pax6 (Biolegend, 901301). The secondary antibodies ...
-
bioRxiv - Cell Biology 2021Quote: ... KRT14 (Rabbit, 1:1000, BioLegend), KRT17 (Rabbit ...
-
bioRxiv - Immunology 2020Quote: ... and rabbit anti-involucrin (BioLegend) antibodies ...
-
bioRxiv - Neuroscience 2022Quote: ... rabbit-β-Tubulin 3 (BioLegend) and mouse-STEM101 (Takara Bio) ...
-
bioRxiv - Immunology 2022Quote: ... anti-rabbit PE (406421, Biolegend) and anti-mouse AF488 (A21202 ...
-
bioRxiv - Cell Biology 2023Quote: ... rabbit keratin 10 (#905403 Biolegend), mouse keratin 14 (ab7800 Abcam) ...
-
bioRxiv - Developmental Biology 2023Quote: ... rabbit anti-Pax6 (901301, BioLegend), goat anti-FoxA2 (AF2400 ...
-
bioRxiv - Immunology 2023Quote: ... Isotype control rabbit (Biolegend, #910801), rat (Biolegend ...
-
bioRxiv - Neuroscience 2024Quote: ... or Rabbit IgG isotype (BioLegend) to 60 µL of AminoLink™ Plus Coupling Resin (ThermoFisher ...
-
bioRxiv - Immunology 2021Quote: Fluorophore- or biotin-conjugated antibodies specific for human cell-surface antigens and cytokines were as follows: anti-CD71 (CY1G4, BioLegend, DF1513, NovusBio), anti-CD235a (HI264 ...
-
bioRxiv - Immunology 2020Quote: ... OVA and HEL were biotinylated in house to ∼1 biotin per antigen molecule and tetramers constructed as described [14] using streptavidin-PE (Biolegend, CA, USA), streptavidin-APC (Biolegend ...
-
bioRxiv - Immunology 2020Quote: ... CD19+CD138+ plasma cells were isolated from PBMCs by positive selection using biotin conjugated CD138 antibody (352322, Biolegend, San Diego, CA, USA) and Easysep release human biotin positive selection cocktail (17653 ...
-
bioRxiv - Immunology 2024Quote: ... The CD11c-APC-depleted fraction was further incubated with anti-biotin beads (Milteniy Biotec, cat# 130-090-485) and streptavidin-PE/Cy7 (BioLegend, 1:500), followed by another MACS enrichment using MS columns ...
-
bioRxiv - Immunology 2021Quote: ... Following a wash, cells were incubated (RT, 10 min) with Rhesus Fc Receptor Binding Polyclonal Antibody (Biolegend). Desired staining antibodies were added directly to this mixture at indicated dilutions (Supplemental Table 27 ...
-
bioRxiv - Developmental Biology 2020Quote: ... and labeled using a FITC Annexin V and propidium iodide staining kit as per manufacturer’s protocol (BioLegend, 640914). Both EdU- and Annexin V-labeled samples were analyzed on a LSRII flow cytometer (BD Biosciences ...
-
bioRxiv - Microbiology 2021Quote: ... and then stained using fluorescent-labeled monoclonal antibodies as follows: Ly6G-BV421 (1:200, BioLegend, Cat No. 127627); CD45-FITC (1:200 ...
-
bioRxiv - Immunology 2020Quote: ... Fluorescence labeled antibodies (CD209,CD206 et al) and multi cytokines kit were from Biolegend (San Diego, CA, USA). Specific inhibitors were acquired from MedChemExpress (Monmouth Junction ...
-
bioRxiv - Immunology 2021Quote: ... Germinal center B cells were labeled using rat anti-GL7 antibody (FITC; BioLegend, catalog no. 144604, 1:250). Tfh cells were labeled using anti-CD4 antibody (BioLegend ...
-
bioRxiv - Cancer Biology 2022Quote: The cells used in this study were labeled with anti-human B7-H3 monoclonal antibody (Biolegend, clone MIH42) PerCP/Cyanine 5.5 conjugate at 4°C for 45 minutes in the dark ...
-
bioRxiv - Immunology 2022Quote: ... BioLegend) for 30min at 4 °C and intracellular markers (BV421-labeled anti-mouse IFN-γ, Cat# 505830, BioLegend; FITC-labeled anti-mouse IL-2 ...
-
bioRxiv - Microbiology 2022Quote: Single-cell suspensions were incubated and labeled with the following antibodies obtained from BioLegend (San Diego, CA, USA) at a 1:100 dilution ...
-
bioRxiv - Immunology 2020Quote: ... and Nlrp3-/- BMDMs were stained with anti-mouse MHC 1 Kb-PE labeled antibodies (BioLegend, clone AF6-88.5) and they were positive by FACS analysis.
-
bioRxiv - Immunology 2021Quote: ... Splenocytes from donor wildtype mice or from B2m-/- mice were labeled with carboxyfluorescein diacetate succinimidyl ester (CFSE, Biolegend) or with Tag-It Violet (Biolegend) ...
-
bioRxiv - Immunology 2022Quote: ... The samples purified in this way from each group of recipients were then suspended in 100μL buffer and labeled with 1μg per sample of the following Total-seq A antibodies from BioLegend: TotalSeq™-A0198 anti-mouse CD127 (A7R34) ...
-
bioRxiv - Immunology 2023Quote: ... and ST2 were determined by flow cytometric analyses using FITC-labeled anti-mouse FcεRIα (clone MAR-1, BioLegend), APC-labeled anti-mouse CD117 (clone 2B8 ...
-
bioRxiv - Molecular Biology 2023Quote: ... Washed cells were stained with two fluorescently labeled epitope tag-specific antibodies (anti-FLAG PE, Biolegend, cat# 637309), anti-HA Alexa 647 ...
-
bioRxiv - Cancer Biology 2023Quote: ... cells were labeled with an antibody cocktail containing Anti-CD14-PE/Cy7 (Clone 63D3, 367111, BioLegend, 1:100), Anti-CD80-APC (Clone 2D10 ...
-
bioRxiv - Developmental Biology 2023Quote: ... then for 1 hour at room temperature (RT) with biotinylated secondary antibodies and finally with fluorochrome-labeled (BioLegend) or peroxidase-labeled streptavidin (Beckman Coulter) ...
-
bioRxiv - Cancer Biology 2023Quote: ... transgenic T cells were labeled with Tag-it Violet Proliferation and Cell Tracking Dye (Cat No. 425101 Biolegend). The frequency of SMARTA cells that proliferated during culture was determined as described by Gett et al ...
-
bioRxiv - Immunology 2023Quote: ... or MCC:I-Ek (cognate) tethered pMHCII complexes were labeled with Tag-it Violet according to the manufacturer’s instructions (BioLegend). M12 cells and 58α-β- cells were then chilled on ice for 30 minutes ...
-
bioRxiv - Immunology 2024Quote: ... and then stained for 30 minutes on ice with an APC-labeled antibody against CD3 (BioLegend; clone UCHT1), phycoerythrinCy7–labeled (PE-Cy7–labeled ...
-
bioRxiv - Immunology 2023Quote: ... The cells were washed with cold PBS and PE-labeled anti-human IgG Fc secondary antibody (Biolegend, 41070) was added and incubated for 30 min at 4°C ...
-
bioRxiv - Immunology 2024Quote: ... Half of the cryopreserved biopsies from each donor were labeled with TotalSeq-A0252 barcode sequence TGATGGCCTATTGGG (Biolegend 394603), and the other half of the cryopreserved biopsy sample was labeled with MULTI-seq lipid-tag barcode sequence CCTTGGCACCCGAGAATTCCACCACAATG66 ...
-
bioRxiv - Immunology 2024Quote: ... Half of the fresh biopsies from each donor were labeled with TotalSeq-A0251 barcode sequence GTCAACTCTTTAGCG (Biolegend 394601), and the other half of the fresh biopsy sample was labeled with MULTI-seq lipid-tag barcode sequence CCTTGGCACCCGAGAATTCCAGGAGAAGA66 ...
-
bioRxiv - Neuroscience 2020Quote: ... 50-μm brain sections were blocked with normal goat serum for 2 h and incubated overnight using biotin-conjugated anti-HA (Biolegend 901505, 1:500) and anti-parvalbumin (Synaptic Systems 195 004 ...
-
bioRxiv - Neuroscience 2020Quote: ... 50μM coronal sections containing dorsal hippocampus were blocked in normal goat serum for 2 h and incubated overnight using a biotin conjugated anti-HA (Biolegend 901505, 1:500), anti-pS6 244-247 (ThermoFisher 44-923G ...
-
bioRxiv - Immunology 2022Quote: ... Fc receptors were blocked with anti-mouse CD16/CD32 antibodies and stained with fluorophore or biotin-conjugated anti-mouse antibodies (BD Pharmingen, Biolegend, Tonbo or eBioscience) to detect B220 (RA3-6B2) ...
-
bioRxiv - Immunology 2019Quote: ... B220 (PE-Cy5, RA3-6B2, BioLegend, #103210; BV650, RA3-6B2, BioLegend, #103241; PE-Cy7, RA3-6B2, BioLegend, #103222; biotin, RA3-6B2, BD, #553085), CXCR5 (BV421 ...
-
bioRxiv - Immunology 2023Quote: Biotinylated pneumococcal serotype 3 polysaccharide with a 5% biotin load was coupled with high concentration streptavidin-phycoerythrin (SA-PE) and streptavidin-allophycocyanin (SA-APC, both from BioLegend, San Diego, CA) in separate reactions ...