Labshake search
Citations for Roche :
51 - 100 of 3706 citations for ssc mir 17 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2019Quote: ... 100-µL PCR reactions were set using 2x KAPA HiFi Hotstart reagents (Roche) with 1µL extracted gDNA ...
-
Bipartite viral RNA genome heterodimerization influences genome packaging and virion thermostabilitybioRxiv - Molecular Biology 2022Quote: ... A thermocycling program was set on a qRT-PCR machine (Roche LightCycler 480II) (Figure 6b) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... One-step qRT-PCR was performed using the Transcriptor One-Step RT-PCR Kit (Roche) by using 5μL of samples per each 20 μL reaction volume ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RT product was amplified by real-time PCR (Roche LightCycler® 480 PCR instrument) using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The RT product was amplified by real-time PCR (Roche LightCycler® 480 PCR instrument) using PowerUp™ SYBR™ Green Master Mix (Applied Biosystems™) ...
-
bioRxiv - Microbiology 2022Quote: ... quantitative RT-PCR (qRT-PCR) was carried out using a Light-Cycler 480 (Roche, France). As internal controls for mRNA quantification ...
-
bioRxiv - Cancer Biology 2024Quote: ... Real-time RT-PCR was carried out using Real-Time PCR Master Mix (KAPA Biosystems) and following probes and primers on a 7300 Real-Time PCR System (Applied Biosystems ...
-
bioRxiv - Molecular Biology 2022Quote: ... The ARS305 probe was generated by PCR using primers ARS305_probe_F and ARS305_probe_R (Table 1) and the PCR DIG Labeling Mix (Roche). Membranes were imaged using an Azure c600 chemiluminescence Imaging System.
-
bioRxiv - Neuroscience 2019Quote: ... Fluorescin Version 17 (Roche) was used ...
-
bioRxiv - Cell Biology 2023Quote: ... using primer sets specific for OSGIN1 and OSGIN2 and from the Universal ProbeLibrary (Roche, see Table S2 for sequences). Analysis was done with Expression Suite software (Applied biosystems ...
-
bioRxiv - Genomics 2022Quote: ... Real-time quantitative PCR (RT-qPCR) was performed using Power SYBR Green PCR master mix (Roche) to quantify the DNA recovery compared to ChIP input DNA at one embryo equivalency (percent input) ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative RT-PCR (qRT-PCR) was performed using FastStart SYBR Green Master kit (Roche, Indianapolis, IN).
-
bioRxiv - Plant Biology 2019Quote: ... The qRT-PCR was set up as a 10μL reaction using SYBR Green (Roche) in a 384-well plate ...
-
bioRxiv - Molecular Biology 2019Quote: ... A 40 μL PCR is set using Kapa HotStart HiFi reagents (Kapa Biosystems #KK2601) containing 40 pmol ML557 ...
-
bioRxiv - Microbiology 2021Quote: ... by quantitative RT-PCR (qPCR) in Roche Light Cycler 480 (Roche). Primers and probes used for 229E ...
-
bioRxiv - Neuroscience 2022Quote: ... Quantitative RT-PCR was performed with DNA Green reagents (Roche 06402712001) on a LightCycler® 96 system (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... RT-PCR was analyzed using a LightCycler 96 Instrument (Roche Diagnostics) with thermal cycling conditions as follows ...
-
bioRxiv - Developmental Biology 2023Quote: ... Quantitative RT-PCR was performed using a LightCycler 480 II (Roche) and LightCycler DNA Master SYBR Green I detection (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: ... The RT-PCR reaction was performed on LightCycler 96 (Roche, Germany). The comparative CT method was used for analysis.
-
bioRxiv - Plant Biology 2021Quote: ... The RT-qPCR was set up as a 10 μL reaction using Lightcycler 480 SYBR Green Master Mix (Roche) in a 384-well plate ...
-
bioRxiv - Molecular Biology 2024Quote: ... The structure of the lacO–tetO reporter locus was checked by a set of 4 PCRs using Expand Long Template PCR System (Roche) and the following primer pairs ...
-
bioRxiv - Cell Biology 2022Quote: ... and qRT-PCR was measured using gene-specific primers with FastStart SYBR Green PCR Master Mix (Roche) on a StepOne Real-Time PCR System (ThermoFisher) ...
-
bioRxiv - Genetics 2022Quote: ... q-PCR was carried out using the PCR Biosystems Sygreen Blue Mix Separat -ROX (Cat. No. 17-507DB) in a LightCycler 480 Real-Time PCR system (Roche Diagnostics Corp., IN). Quantification was performed using the comparative ΔΔCt method and normalization for internal reference was done using either act-5 or pmp-2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... Transposed chromatin was amplified using customized Nextera PCR Primer 1 and Primer 2 (barcode) (31) and HotStart KAPA ReadyMix (Roche). Libraries were quantified by Qubit using the DS DNA HS kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2023Quote: ... Relative cDNA levels were calculated using the best-fit curve from the standard dilution of each primer set using supplied software from Roche and then normalized against the internal reference gene cDNA signal ...
-
bioRxiv - Immunology 2023Quote: ... PCR primers were designed by LightCycler® Probe Design Software from Roche. Real-time PCR was performed using custom TaqMan Gene Expression Assay reagent on QuantStudio 12K Flex Real-Time PCR System (Thermo Scientific).
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative RT-PCR (qRT-PCR) was permorfed in triplicates using FastStart universal SYBR Green master Mix (Roche). Melting curves were analyzed (SYBR green ...
-
bioRxiv - Developmental Biology 2019Quote: ... Quantitative RT-PCR (Q-PCR) was performed using a LightCycler 480 II (Roche Life Science, Penzberg, Germany) and LightCycler DNA Master SYBR Green I detection (Roche ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative RT-PCR (qRT-PCR) reactions were performed as described using the Universal Probe Library system (Roche). Actin and tubulin predeveloped TaqMan assays (Applied Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... Reverse transcription with ensuing PCR steps was performed using a Transcriptor One-Step RT-PCR kit (Roche) with EBOV-specific primers ...
-
bioRxiv - Cancer Biology 2023Quote: ... qRT-PCR analyses were performed using LightCycler® 480 SYBR Green I Master RT-PCR kits (ROCHE) on a Bio-Rad CFX Connect Real-Time system (Bio-Rad ...
-
bioRxiv - Microbiology 2020Quote: ... previously published assay (“one-step real-time RT-PCR E assay”) using the One-Step RT-qPCR kit (Roche Diagnostics). For each run ...
-
bioRxiv - Genomics 2019Quote: ... A 100 µL PCR reaction is set using Kapa HotStart HiFi reagents (Kapa Biosystems #KK2601) containing 150 pmol each primer and 10 ng plasmid template ...
-
bioRxiv - Molecular Biology 2019Quote: ... A 100 μL PCR reaction is set using Kapa HotStart HiFi reagents (Kapa Biosystems #KK2601) containing 125 pmol ML1125 ...
-
bioRxiv - Molecular Biology 2019Quote: ... A 100 μL PCR reaction is set using Kapa HotStart HiFi reagents (Kapa Biosystems #KK2601) containing 125 pmol ML1125 ...
-
bioRxiv - Genomics 2020Quote: ... Quantitative PCR (RT-qPCR) was performed on a Light Cycler 480 (Roche) with MasterMix SYBRGreen (Roche ...
-
bioRxiv - Cancer Biology 2019Quote: ... Quantitative RT-PCR was applied under standard conditions using SYBR Green (Roche) on a LightCycler 480 (Roche) ...
-
bioRxiv - Physiology 2021Quote: ... Sybr Green real-time RT-PCR assay probes (Roche Universal Probe library): Fw 5’gagcgtcgcagagaacttaga3’ and Re 5’ ttcctctggtaggcgattctt3’ (CALDESMON) ...
-
bioRxiv - Plant Biology 2020Quote: ... Quantitative RT-PCR was performed using the SYBR Green kit (Roche, Belgium) with 100 nM primers and 0.125 μl of RT reaction product in a total volume of 5 μl per reaction ...
-
bioRxiv - Developmental Biology 2022Quote: RNA preparation for RT-PCR was performed using TriPure Isolation Reagent (Roche). Reverse transcription was performed using PrimeScript™ II Reverse Transcriptase (Takara) ...
-
bioRxiv - Neuroscience 2020Quote: ... RT-PCR was taken using a Light Cycler 480 system (Roche, Germany) with double-stranded DNA dye SYBR Green (RR091A ...
-
bioRxiv - Cancer Biology 2021Quote: ... RT-PCR experiments were performed on a LightCycler® 480 Instrument (Roche).
-
bioRxiv - Neuroscience 2019Quote: ... Quantitative RT-PCR was performed with the LightCycler® 1536 Instrument (Roche), and the following primers:
-
bioRxiv - Microbiology 2019Quote: ... Quantitative RT-PCR was carried out using a LightCycler 480 instrument (Roche Molecular Biochemicals ...
-
bioRxiv - Genetics 2021Quote: ... and eIF4E were estimated by RT-PCR (LightCycler 480 II, Roche, Switzerland) using the SYBR Green Master.
-
bioRxiv - Immunology 2020Quote: ... RT-qPCR was performed using the LightCycler 480 II PCR System (Roche) with the following program ...
-
bioRxiv - Genomics 2022Quote: ... RT-qPCR quantification was conducted using a LightCycler 480 PCR platform (Roche) set with the following cycling conditions ...
-
bioRxiv - Cell Biology 2021Quote: ... The RT-PCR was performed on individual cDNAs using SYBR green (Roche) [39] ...
-
bioRxiv - Plant Biology 2022Quote: Quantitative RT-PCR was performed using a LightCycler 96 (Roche, Basel, Switzerland). Thunderbird SYBR qPCR Mix (Toyobo ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time RT-PCR was performed with LightCycler® 480 II (Roche) using DyNAmo ColorFlash SYBR Green (Thermo Scientific) ...