Labshake search
Citations for Roche :
351 - 400 of 3706 citations for ssc mir 17 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2020Quote: ... First round of PCR amplification was performed using primers CGTTCAGAGTTCTACAGTCCGACGATCHHHHACHHHHACHHHNGCAGCCCATGGTACCA GCAGTTCC and ACTGGAGTTCCTTGGCACCCGAGAATTC using HotStart Kappa HIFI ready mix (Kapa Biosystems) and the following conditions ...
-
bioRxiv - Microbiology 2022Quote: The V4 hypervariable region of the 16S rRNA gene was amplified with the primer pair 515F (5′-GTGCCAGCMGCCGCGGTAA-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3) on a Fast Start High Fidelity PCR System (Roche, PQ) using the following conditions ...
-
bioRxiv - Immunology 2022Quote: Purified DNA from mouse fecal pellets or sorted cells was subjected to 16S variable region 4 PCR amplification using barcoded 515F and 806R primers (47) and the KAPA2G Robust HotStart ReadyMix (KAPA Biosystems), with the following cycling conditions ...
-
bioRxiv - Developmental Biology 2021Quote: ... Fixed embryos were placed into hybridization buffer (50% formamide, 5×SSC, 1 mg/ml yeast tRNA (Roche, 10109223001), 100 μg/ml heparin (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2020Quote: ... and then prehybridized (50% formamide [ThermoScientific 15515026], 5X SSC [ThermoScientific AM9763], 1X denhardt’s solution [Sigma D2532], 250ug/mL Brewer’s yeast tRNA [Roche 10109495001] ...
-
bioRxiv - Microbiology 2022Quote: ... The viral stocks were quantified by measuring the reverse transcriptase (RT) activity using either a qPCR-based product-enhanced RT (PERT) assay68 or a colorimetric RT assay (Roche Life Sciences).
-
bioRxiv - Genomics 2020Quote: ... 0.25ug random primers (Roche, UK), 1x reverse transcriptase buffer and 200U RevertAid reverse transcriptase in a total volume of 20ul ...
-
bioRxiv - Cancer Biology 2022Quote: ... and random hexamer primers (Roche). mRNA expression was analyzed in duplicate by quantitative real-time PCR and the relative expression of each gene was quantified by the comparative cycle threshold method (ΔΔCt ...
-
bioRxiv - Developmental Biology 2019Quote: ... Primers and UPL probes (Roche) used are detailed in Supplementary table 2 ...
-
bioRxiv - Microbiology 2019Quote: ... and random hexamer primers (Roche). Viral loads were determined by TaqMan qPCR ...
-
bioRxiv - Cell Biology 2019Quote: ... 200 nM primers (using Roche Diagnostics Universal ProbeLibrary System Assay Design ACTB ...
-
bioRxiv - Cancer Biology 2023Quote: ... with random hexamer primers (Roche) to produce cDNA from 2 micrograms total RNA ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and random hexamer primers (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... cDNA synthesis was performed with a 1 μg RNA sample using the First Strand cDNA Synthesis kit RT-PCR (Roche, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... and 6.8 μL ddH2O were used and the RT-qPCR was performed using a Light Cycler 96 Real-Time PCR Machine (Roche, Germany). Expression levels were calculated using the 2-ΔCT equation (Kilambi et al. ...
-
bioRxiv - Microbiology 2019Quote: ... Quantification of viral RNA was performed using a real-time RT-PCR assay specific for HTNV nucleocapsid coding region in a LightCycler® 96 (Roche) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: ... 1 µl of the newly synthesized cDNA was then used to perform quantitative RT-PCR was in LightCycler 480 SYBR Green I Master (Roche, 04707516001) according to the protocol below on a LightCycler 480 Instrument or the QuantStudio 6 Flex instrument (Applied Biosystems ...
-
bioRxiv - Physiology 2021Quote: ... DNase treatment was performed on 300 ng RNA prior to Reverse Transcription Polymerase Chain Reaction (RT-PCR) using RNAse-free DNAse I (Roche, # 04716728001) at 37°C for 10 min ...
-
bioRxiv - Molecular Biology 2023Quote: ... The same proportion of cDNA products of each sample was used as template for the quantitative RT-PCR reaction with Light Cycler 480 SYBR Green I Master Mix (Roche, 04707516001). The Ct value was used to represent the absolute amount of EU-RNAs in each sample ...
-
bioRxiv - Microbiology 2022Quote: ... all samples underwent primary PCR amplification (30 cycles) using the conventional V4 primers (515F-806R) and KAPA HiFi Hot Start DNA polymerase (KAPA Biosystems, USA), and secondary PCR was performed to add dual-indexes (IDT ...
-
bioRxiv - Molecular Biology 2019Quote: ... 1 μl of TruSeq PCR primer cocktail (50 μM) and 20 μl of KAPA HiFi HotStart ReadyMix (KAPA Biosystems, cat. no. KK2601). USER digestion was performed at 37 °C for 15 min ...
-
bioRxiv - Genetics 2019Quote: ... of each library was used for bar-coding amplification using dual-barcoded single-stranded library adapters44 as primers in the following 100 μl volume reaction: 10 μl 10x PCR Buffer + MgCl2 (Roche, Basel, Switzerland) 0.4 μM of each primer ...
-
bioRxiv - Molecular Biology 2020Quote: ... 1 μl of TruSeq PCR primer cocktail (50 μM) and 20 μl of KAPA HiFi HotStart ReadyMix (KAPA Biosystems, cat. no. KK2601). USER digestion was performed at 37 °C for 15 min ...
-
bioRxiv - Cancer Biology 2019Quote: ... The primers used for real-time PCR were designed based on the Universal Probe Library (Roche, Roche Life Science, Pleasanton, CA, USA) with GAPDH as reference ...
-
bioRxiv - Plant Biology 2020Quote: ... Blots were hybridized with a digoxygenin (DIG)-labeled ZmPEPC promoter-specific probe synthesized using primers (Fwd 5’-TCCCGAGTTCCTAACCACAG; and Rev 5’-GTGGCTGAGGCTTCTTTTTG) and the PCR DIG Probe Synthesis Kit (Roche Diagnostics, Switzerland). The signals were detected by CDP-Star (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2020Quote: ... to amplify the ligation product with 5 PCR cycles using 2x KAPA-HiFi HS Ready Mix and 10X KAPA primer mix (Roche Kapa Biosystems). The libraries were sequenced on HiSeq 4000 or NovaSeq 6000 (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... was used for PCR amplification of all tested genome fragments from AF associated loci (for primers used see Supplementary Table S1) using Expand High Fidelity PCR system (Roche ref. 11732650001). Primers were design using NEBuilder assembly tool to have 20-basepair (bp ...
-
bioRxiv - Microbiology 2023Quote: The qRT-PCR experiments were performed using specific oligonucleotide primers and hot-start polymerase (SYBR Green Fast Master Mix; Roche Diagnostics, Germany). The amplification cycles were performed using a C1000 Touch Thermal cycler (Biorad ...
-
bioRxiv - Cell Biology 2024Quote: ... mRNA levels were determined using gene-specific primers by SYBR green nucleic acid labeling (Selleckchem PCR Mastermix, #B21202) in a Lightcycler 480 (Roche, Indianapolis, IN). Fold change was calculated using the delta delta C(t ...
-
bioRxiv - Plant Biology 2020Quote: ... MpC1HDZ was amplified from cDNA using a specific forward primer and polyT reverse primer (Roche) and ligated into pGEMT ...
-
bioRxiv - Genetics 2022Quote: ... and DIG Wash and Block Buffer Set (Roche 11585762001) according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... KAPA single indexed adaptor set A (KAPA biosystems, KK8701) was used for adaptor ligation ...
-
bioRxiv - Developmental Biology 2021Quote: ... 2% blocking powder from Roche, 5X SSC, 0.1% TritonX, 0.1% CHAPS from Sigma Aldrich, 50% formamide, 1 mg/ml tRNA from Roche, 5 mM EDTA from Sigma and 50 μg/ml Heparin from Sigma ...
-
bioRxiv - Neuroscience 2019Quote: ... slides were washed using several steps of SSC washes (2xSSC, 0.2xSSC) and incubated with blocking solution (FBS heat inactivated, blocking reagent (Roche). Probes were detected using a 1h incubation at RT with anti-fluorescein-POD (1:2500 ...
-
bioRxiv - Developmental Biology 2020Quote: ... washed three times 15 min each in PBST and pre-incubated for 1h at 60°C in Hybridization Buffer (HB: 50% Formamide, 2X SSC, 1mg/ml Torula RNA, 0.05mg/ml, Heparin, 2% Roche blocking reagent ...
-
bioRxiv - Genomics 2021Quote: ... the bacteria pellets were re-suspended in 150 µL of SSC 1X with 0,4 mM protease inhibitor cocktail (Roche) and cells disrupted with a FastPrep Instrument using 0.1g of glass beads (500µm ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG-labelled cDNA probe was incubated at 95 °C for 10 min and immediately placed in the ice for 5 min before adding to the hybridization buffer (5x SSC, 50 % formamide, 0.02 % SDS, 2 % blocking agent (Roche), DEPC-treated water) ...
-
bioRxiv - Developmental Biology 2022Quote: ... The sections were washed with 2 X SSC and 0.2 X SSC for 20 min followed by incubation in a blocking solution containing 2% blocking reagent (Roche) and 20% sheep serum for 1 hr ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were incubated in 50% Hybridization Buffer (50% formamide, 2x SSC, 1 mg/ml Torula RNA, 0.05 mg/ml Heparin, 2% Roche blocking reagent ...
-
bioRxiv - Immunology 2022Quote: ... measured by RT ELISA (Roche), per well (MOI 0.2 ...
-
bioRxiv - Cell Biology 2020Quote: ... Mip1α and housekeeping gene β-actin was evaluated by quantitative RT-PCR using the LightCycler 480 SYBR Green 1 Master kit and LightCycler 480 II (Roche, Indianapolis, IN) and oligos ...
-
bioRxiv - Molecular Biology 2021Quote: RNA template (500 ng) was used for one-step RT-PCR amplification protocol (SYBR Green I RNA amplification kit, Roche, Basel, Switzerland). Primers were designed using the LC Primer/Probe design software (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Samples were subsequently transferred to 384-well plates for analysis by RT-qPCR on the 480 Real-Time PCR system (Roche, Basel, Switzerland) using the One-Step TB Green PrimeScript RT-PCR Kit II (Takara ...
-
bioRxiv - Bioengineering 2024Quote: ... RNA was added to optimized 10 µM primer/probe mix in Mastermix (Quantabio, qScript™ XLT One-Step RT-qPCR ToughMix®) and run on StepOne Plus real-time PCR (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2024Quote: ... Gene expression levels were quantified by Reverse Transcription quantitative polymerase chain reaction (RT–qPCR) using the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland). Cycling parameters were set at (i ...
-
bioRxiv - Microbiology 2021Quote: ... and Fwd-P2 (5′-CCATCTCATCCCTGCGTGTCTCCGACTCAGBBBBBBAGARTTTGATCYTGGTTCAG and the reverse primer was Rev1B (5′-CCTATCCCCTGTGTGCCTTGGCAGTCTCAG. The PCR products were sequenced on the 454 GS FLX Titanium sequencer (Hoffmann-La Roche, LTD; Basel, Switzerland). Through the Research Alliance for Microbiome Science Registry (IRB no ...
-
bioRxiv - Plant Biology 2023Quote: ... The screening for hCas9 presence was performed using primers reported in Data S1 by PCR using KAPA HIFI Taq (Kapa Biosystems, Boston, USA) with the following program ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and primer premix (Kapa Biosystems, UK). Libraries were pooled in equimolar concentrations and pairs of 125 bp sequences were produced on two lanes of Illumina HiSeq 2500 at Biomedical Research Centre Genomics ...
-
bioRxiv - Physiology 2019Quote: ... and random hexamer primers (Roche Diagnostics). Quantitative real-time PCR was performed with primers for SMAD3 ...
-
All-Flesh Tomato Regulated by Reduced Dosage of AFF Provides New Insights into Berry Fruit EvolutionbioRxiv - Plant Biology 2021Quote: ... The primers were designed by Roche LCPDS2 software and were synthesized by Beijing TsingKe Biological Technology Co. ...