Labshake search
Citations for Roche :
401 - 450 of 5243 citations for WD Repeat Containing Planar Cell Polarity Effector WDPCP Antibody Biotin since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2019Quote: ... containing freshly added phosphatase (phosSTOP, Roche) and protease inhibitors (cOmplete EDTA-free ...
-
bioRxiv - Neuroscience 2020Quote: ... containing protease inhibitors (Complete Mini; Roche). Lysates were centrifuged (10.000g for 10 min at 4°C ...
-
bioRxiv - Neuroscience 2020Quote: ... containing protease inhibitors (Complete Mini; Roche)) ...
-
bioRxiv - Cell Biology 2020Quote: ... containing protease inhibitor cocktail (Roche #11873580001). The lysates were boiled for 10 min at 95°C and clarified by centrifugation at 12 ...
-
bioRxiv - Microbiology 2020Quote: ... containing protease inhibitors (Roche, MA, USA). SARS-CoV-2 S-Ectodomain expressing Tni cell media were treated with different concentrations of bromelain (5 ...
-
bioRxiv - Neuroscience 2020Quote: ... containing a protease inhibitor cocktail (Roche) and phosphatase inhibitors (AG Scientific ...
-
bioRxiv - Cell Biology 2020Quote: ... containing an antiprotease cocktail (Roche Diagnostic). Cells were incubated for 20 minutes on a rotating wheel ...
-
bioRxiv - Neuroscience 2022Quote: ... containing protease and phosphatase inhibitors (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... D6750)] containing protease inhibitor cocktail (Roche, 04693159001) and phosphatase inhibitor cocktail (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... containing proteinase and phosphatase inhibitors (Roche), centrifuged for 10 min at 8,000 × g at 4°C and supernatant extracted and stored at −80°C ...
-
bioRxiv - Neuroscience 2021Quote: ... containing protease inhibitor cocktail (Roche #4693159001) and PhosSTOP (Roche #4906837001 ...
-
bioRxiv - Neuroscience 2020Quote: ... containing collagenase P (Roche, Penzberg, DE) (0.2 U/mL ...
-
bioRxiv - Microbiology 2021Quote: ... containing protease inhibitors (Roche Applied Science). Cell lysates were normalized for protein content with Pierce 660nm Protein Assay (Thermo Scientific) ...
-
bioRxiv - Biochemistry 2020Quote: ... containing 2x protease inhibitor cocktail (Roche); centrifuged at 12,000 rpm for 10 min at 4 °C to get rid of cell debris ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing protease inhibitor cocktail (Roche, 4693159001). Lysates were placed on ice for 30 minutes followed by sonication for 2 minutes with 10 seconds on/off cycle and centrifugation for 10 minutes at 10000g at 4°C in a microcentrifuge ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing protease inhibitor (Roche, Basel, Switzerland) and phosphatase inhibitor (Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2019Quote: ... containing 1% RNAse inhibitor (Roche, #03335399001) and 1% DNAse I (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... containing DIG DNA-labelling mix (Roche) and primers DENV-1 3’UTR FW (AGTCAGGCCAGATTAAGCCATAGTACGG ...
-
bioRxiv - Pathology 2021Quote: ... containing complete mini protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Cell Biology 2019Quote: ... containing protease inhibitors (cOmplete tablets; Roche) and phosphatase inhibitors (PhosSTOP ...
-
bioRxiv - Biochemistry 2020Quote: ... containing 2x protease inhibitor cocktail (Roche); protein concentrations were determined by BCA assay ...
-
bioRxiv - Cell Biology 2019Quote: ... containing 0.8U/ml Liberase TM (Roche) and 1mg/ml DNAse (Sigma) ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing a protease inhibitor cocktail (Roche). Equal amounts of proteins were resolved using sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...
-
bioRxiv - Cell Biology 2020Quote: ... pH 7.4) containing protease inhibitors (Roche) and phosphatase inhibitors (5mM sodium fluoride ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing protease inhibitor (Roche, Basel, Switzerland). The resultant lysates were centrifuged at 6000 rpm for 10 mins ...
-
bioRxiv - Systems Biology 2021Quote: ... pH 8.0) containing protease inhibitor (Roche) for 30 min ...
-
bioRxiv - Neuroscience 2021Quote: ... containing protease inhibitor cocktail (Roche 11697498001), then incubated on ice for 45 minutes with occasional gentle agitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... containing Protease inhibitors (Roche, cat# 04693159001) and Phosphatase inhibitors (Thermo Fisher Scientific ...
-
CREB5 reprograms nuclear interactions to promote resistance to androgen receptor targeting therapiesbioRxiv - Cancer Biology 2021Quote: ... containing protease inhibitor cocktail (Roche, 11836145001). Cells were then sonicated with a Covaris sonicator to yield DNA fragments averaging around 3000 nucleotides ...
-
bioRxiv - Cell Biology 2021Quote: ... containing cOmplete protease inhibitor cocktail (Roche) and phosphatase inhibitor cocktail (Nacalai ...
-
bioRxiv - Cancer Biology 2020Quote: ... containing cOmplete protease inhibitor cocktail (Roche) and PMSF (Cell Signaling Technology ...
-
bioRxiv - Cell Biology 2022Quote: ... containing 1x protease inhibitor (5892970001, Roche), 1x phosphatase inhibitor (4906837001 ...
-
bioRxiv - Molecular Biology 2022Quote: ... containing complete protease inhibitor cocktail (Roche). Lysed cell suspensions were rotated in 4°C for 1 hour ...
-
bioRxiv - Cancer Biology 2022Quote: ... containing cOmplete Protease Inhibitor Cocktail (Roche), PhosSTOP phosphatase inhibitors (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... containing 10 μM oseltamivir carboxylate (Roche) and 10 μM zanamivir (GSK ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... containing “Complete” protease inhibitor cocktail (Roche) for 15 min on ice with occasional mixing ...
-
bioRxiv - Microbiology 2022Quote: ... containing 10 μM oseltamivir carboxylate (Roche) and 10 μM zanamivir (GSK ...
-
bioRxiv - Immunology 2022Quote: ... containing protease inhibitor cocktail (Roche, 589297001) and phosphatase inhibitors (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5% NP40 containing proteasome inhibitors (Roche). Lysates were analyzed by SDS-PAGE using standard techniques ...
-
bioRxiv - Immunology 2023Quote: ... containing 250 μg/ml liberase (Roche) and 100 μg/ml DNase I (Roche) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 0.1% SDS) containing protease inhibitors (Roche) and phosphatase inhibitors (Sigma) ...
-
bioRxiv - Neuroscience 2023Quote: ... containing DAPI (0.5 µg/ml; Roche).
-
bioRxiv - Pathology 2023Quote: ... containing complete TM protease inhibitors (Roche). Samples were incubated on ice for 1 hour and centrifuged at 18,000 x g for 30 minutes at 4 °C ...
-
bioRxiv - Microbiology 2023Quote: ... containing 0.3% BSA (fraction V; Roche), 10 mM HEPES (Corning) ...
-
bioRxiv - Neuroscience 2023Quote: ... containing protease inhibitors (cOmplete Tablets, Roche) in gentleMACS M tubes using a gentleMACS dissociator (Miltenyi Biotec ...
-
bioRxiv - Cancer Biology 2023Quote: ... containing a protease inhibitor cocktail (Roche) and benzonase (Thermofisher) ...
-
bioRxiv - Cell Biology 2023Quote: ... containing a protease inhibitor cocktail (Roche) and 25 mM β-Glycerophosphate ...
-
bioRxiv - Cell Biology 2023Quote: ... containing Complete Protease Inhibitor Cocktail (Roche). After centrifugation at 100,000 × g at 4 °C for 16 h ...
-
bioRxiv - Neuroscience 2023Quote: ... pH 8.0) containing protease (Roche, 05892970001) and phosphatase inhibitors (Roche ...
-
bioRxiv - Neuroscience 2023Quote: ... containing protease inhibitors (Roche Diagnostics GmbH) and 0.2 mM PMSF (phenylmethylsulphonyl fluoride ...