Labshake search
Citations for Roche :
101 - 150 of 5227 citations for Uric Acid Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... ADCC was measured using LDH release assay (Cytotoxicity Detection Kit (LDH) (Roche; cat. no. 11644793001) after 4 h incubation at 37°C.
-
bioRxiv - Microbiology 2023Quote: ... qPCR assay was prepared using KAPA SYBR® FAST qPCR Kit (Kapa Biosystems, MA, USA) and performed on an Applied Biosystems ViiA™ 7 Real-Time PCR System according to the manufacturer’s instruction ...
-
bioRxiv - Neuroscience 2023Quote: ... TUNEL assay was performed using the In-Situ Cell Death Detection Kit (TMR Red) (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... The TUNEL assay was performed using the In Situ Cell Death Detection Kit (Roche Diagnostics) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Cell apoptosis was detected by TUNEL assay with In Situ Cell Death Detection Kit (Roche) following the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... and cellular ATP content was measured using the ATP Bioluminescence Assay Kit CLSII from Roche and a Lumat 9705 instrument from Berthold.
-
bioRxiv - Plant Biology 2023Quote: ... Real-time quantitative PCR assays were prepared using KAPA SYBR FAST qPCR kit (Kapa Biosystems) and run on an Applied Biosystems QuantStudio 12K QPCR instrument ...
-
bioRxiv - Plant Biology 2024Quote: ... Real-time quantitative PCR assays were prepared using KAPA SYBR FAST qPCR kit (Kapa Biosystems) and run on an Applied Biosystems QuantStudio 12K QPCR instrument ...
-
bioRxiv - Physiology 2019Quote: ... Free fatty acid and triglyceride levels were measured in serum using the colorimetric quantification kits Half-micro test (Roche) and Infinity (ThermoScientific) ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Immunology 2023Quote: ... fatty acid free (Roche, Basel, Switzerland), 50 μmol/L 2-mercaptoethanol (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... apoptotic cells in pancreas frozen sections were detected by the TUNEL (TdT mediated dUTP nick end labeling) assay using a fluorescein-based detection kit (in situ death detection kit, Roche, Indianapolis, IN) according to manufacturer’s instructions ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Genomics 2019Quote: ... The supernatants from the digestion and initial decalcification step were purified using a 5 M guanidine-hydrochloride binding buffer with a High Pure Viral Nucleic Acid Large Volume kit (Roche). The extract was eluted in 100 μl of a 10mM tris-hydrochloride ...
-
bioRxiv - Microbiology 2020Quote: ... Viral transport media was added to each pool at a 1:1 ratio for nucleic acid extraction performed on the Roche MagNA Pure 24 platform using the MagNA Pure 24 Total NA Isolation kit (Roche). Elution volume was set to 50 ul to concentrate viral RNA ...
-
bioRxiv - Microbiology 2021Quote: ... was extracted from inactivated samples (200 μL) using the MagNA Pure Compact instrument and MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Molecular Systems Inc ...
-
bioRxiv - Microbiology 2019Quote: ... Sendai Virus (SeV) and Modified vaccinia Ankara (MVA)-gfp viral stocks were extracted using the High Pure Viral Nucleic Acid Kit (Roche). When indicated ...
-
bioRxiv - Microbiology 2020Quote: ... whole specimens were processed into head/thorax homogenates for RNA extraction with the High Pure Viral Nucleic Acid Kit (Roche), according to manufacturer’s instructions (Moreira et al. ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from homogenized tissue of adenovirus vectored vaccine inoculated mice by High Pure Viral Nucleic Acid Kit (Roche). DNA fragments of Sad23L and Ad49L vectors were amplified by nested PCR with primers specific to adenoviral hexon sequences (Table S4 ...
-
bioRxiv - Microbiology 2022Quote: ... lacking the predicted signal peptide (amino acids 1-29) was amplified from genomic DNA (isolated using the High Pure Template kit, Roche) by PCR using the Phusion Hot start II High Fidelity DNA Polymerase (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2023Quote: ... and nucleic acid extracted using the MagNA 96 instrument with DNA/Viral NA small volume kits (Roche, Laval, Quebec, Canada). Ophidiomyces ophidiicola was not detected in these samples by qPCR (Allender et al ...
-
bioRxiv - Cell Biology 2020Quote: Intracellular ATP levels were determined by an ATP Bioluminescence Assay Kit (Roche Applied Science, Mannheim, Germany), according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2019Quote: ... The SIV3vpx particles were quantified after thawing using a reverse transcriptase (RT) assay colorimetric kit (Roche) following the manufacturer’s instructions to provide a RT ng/mL titre.
-
bioRxiv - Cell Biology 2020Quote: TG content was measured with an enzymatic GPO-PAP assay kit (Cobas, Roche/Hitachi, Tokyo, Japan) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... Apoptosis was analyzed using TUNEL assay by an In Situ Cell Death Detection kit (11684795910, Roche). As counterstain for IF and IHC stainings Hoechst or DAPI staining was used ...
-
bioRxiv - Developmental Biology 2021Quote: ... assays were carried out using the in Situ Cell Death Detection Kit (11684795910; Roche, Basel, Switzerland) as previously described (Liu et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... The TUNEL cell death assay was performed using the In Situ Cell Death Detection Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... ADCC was measured using the LDH release assay (Cytotoxicity Detection Kit (LDH) (Roche; cat. no. 11644793001) after 4 h incubation at 37°C.
-
bioRxiv - Cancer Biology 2024Quote: ... cell viability was evaluated using the XTT Cell Proliferation Assay Kit II (Roche Diagnostics, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... 0.1% deoxycholic acid and protease inhibitors (Roche), and thrice with lysis buffer without detergent ...
-
bioRxiv - Cell Biology 2023Quote: ... containing 0.5% fatty acid-free BSA (Roche), 10 mg ml-1 Collagenase D (Roche) ...
-
bioRxiv - Neuroscience 2023Quote: ... 0.1% deoxycholic acid with protease inhibitors (Roche). The lysates were subject to anti-GFP immunoprecipitation using GFP-Trap beads or anti-Myc immunoprecipitation using Myc-Trap beads (ChromoTek) ...
-
bioRxiv - Plant Biology 2023Quote: ... ethylenediaminetetraacetic acid free protease inhibitor mixture (Roche) and phosphatase inhibitor mixture (Sigma-Aldrich) ...
-
Caspase-8 Modulates Angiogenesis By Regulating A Cell Death Independent Pathway In Endothelial CellsbioRxiv - Developmental Biology 2019Quote: ... TUNEL assay (Roche) was performed according to manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 0.05% (v/v) Tween-20) and processed through the spin columns from High Pure Viral Nucleic Acid Large Volume kits (Roche, Switzerland). Purified DNA was eluted in either 45 µl of EB buffer (10 mM tris-hydrochloride (pH 8.0 ...
-
bioRxiv - Microbiology 2020Quote: ... DNA extractions performed at the MPI-SHH substituted the column apparatus from the High Pure Viral Nucleic Acid Large Volume Kit (Roche, Switzerland) in place of the custom assembled Zymo-reservoirs coupled to MinElute (Qiagen ...
-
bioRxiv - Cancer Biology 2020Quote: ... three-to-four 5μm FFPE samples sections were taken for RNA extraction using commercial FFPE nucleic acid isolation kit (Roche Molecular Diagnostics). RNA was quantified using Nanodrop and analyzed for fragment distribution using a bioanalyzer (Agilent) ...
-
bioRxiv - Biochemistry 2021Quote: ... the amino acid Thr at position 206 was mutated to Trp using KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems, USA) together with the designed complementary primers (5’- CCTATCTGATTCATGAGCACATGGTTATTTGGGATCGCATTGAAAAC-3’ and 5’- GTTTTCAATGCGATCCCAAATAACCATGTGCTCATGAATCAGATAGG-3’ ...
-
bioRxiv - Plant Biology 2022Quote: ... The products then transferred from the gel to Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics) according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2022Quote: ... The products were then transferred from the gel to the Hybond N+ Nylon membrane (Amersham Biosciences) and detected using DIG Nucleic Acid Detection Kit (Roche Diagnostics), according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2022Quote: Viral RNA was extracted using the MagNA Pure 96 DNA and Viral Nucleic Acid kit on the MagNA Pure 96 system (Roche Diagnostics) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: RNA from specimens from Cyprus underwent automated total nucleic acid extraction using the MagNA Pure 96 DNA AND Viral NA Small Volume kit (Roche Diagnostics). RT-PCR for FCoV was performed at Laboklin Bad Kissingen ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... but replaced the Zymo-Spin V column binding apparatus with a high pure extender assembly from the High Pure Viral Nucleic Acid Large Volume Kit (Roche 05114403001). Double-stranded Illumina libraries were prepared using the Blunt-End Single Tube (BEST ...
-
bioRxiv - Microbiology 2020Quote: ... The DNA fragmentation assay used the Cell Death Detection ELISA kit (initially from Roche, later Millipore-Sigma). Phosphatidylserine was detected by FITC-conjugated annexin V (Sigma) ...
-
bioRxiv - Microbiology 2021Quote: ... ATP concentrations were determined using the ATP Bioluminescence Assay Kit CLS II (Roche 11699695001, from Sigma-Aldrich) according to manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2021Quote: Cell membrane integrity was measured via the lactate dehydrogenase activity (LDH) release assay (Roche Cytotoxicity Detection Kit). Media from the bottom channel was continuously collected in 15 minutes intervals (both for the unstretched and stretched mimicking VILI) ...