Labshake search
Citations for Roche :
401 - 450 of 5227 citations for Uric Acid Microplate Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... Q-PCR was performed with SYBR green-based gene expression assays (Roche). Primer sequences are available on request.
-
bioRxiv - Physiology 2021Quote: ... Sybr Green real-time RT-PCR assay probes (Roche Universal Probe library): Fw 5’gagcgtcgcagagaacttaga3’ and Re 5’ ttcctctggtaggcgattctt3’ (CALDESMON) ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal Probe Library Assay Design Centre (Roche), compatible with UPLs 157 (ActB) ...
-
bioRxiv - Developmental Biology 2022Quote: ... And then qPCR assays were performed on the LightCycler 480 II (Roche) in 10μL reaction volume containing 6μL of SYBR green Master mix (Fisher Scientific A25918) ...
-
bioRxiv - Microbiology 2020Quote: ... Cell viability was measured by WST-1 assay following manufacture’s protocol (Roche). The IC50 and CC50 were calculated using a four-parameter logistic regression model from the GraphPad Prism 5 software (GraphPad Software Inc.).
-
bioRxiv - Bioengineering 2021Quote: Primers were designed using the Universal Probe Library Assay Design Center (Roche) and checked for specificity against the Physcomitrella transcriptome in the Phytozome database (Goodstein et al. ...
-
bioRxiv - Cell Biology 2020Quote: ... The assay was followed according to the manufacturers protocol (Roche Applied Science).
-
bioRxiv - Cell Biology 2021Quote: ... Te assay was performed according to the instructions of the vendor (Roche). The population doubling time was computed as the ln(2)/slope of the proliferation growth curve using Prism software ...
-
bioRxiv - Biochemistry 2022Quote: ... TUNEL assay was carried out according to manufacturers instructions (Roche Diagnostics, IN). Primary antibodies were visualized with species-specific secondary antibodies conjugated to fluorescent probes ...
-
bioRxiv - Biophysics 2022Quote: ... Cytotoxicity was also performed at matched concentrations using the MTT assay (Roche), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Primers were designed using the Universal Probe Library Assay Design Center (Roche). Quantitative PCR was carried out using a LightCycler 96 (Roche ...
-
bioRxiv - Microbiology 2023Quote: ... All qPCR assays were carried out on a LightCycler 480 (Roche Diagnostics) using the LightCycler 480 software version 1.5.1.
-
bioRxiv - Microbiology 2023Quote: ... qPCR assays were performed with a Light Cycler 480 II instrument (Roche), using the Maxima TM SYBR Green/ROX qPCR Master Mix (2X ...
-
bioRxiv - Immunology 2023Quote: ... The qPCR assays were done with FastStart Essential DNA Green Master (Roche) with the primers are listed in supplementary methods.
-
bioRxiv - Cell Biology 2024Quote: ... WST-1 assays to measure cell proliferation rate (Roche Cat. No. 5015944001) were conducted using the manufacturer’s protocol.
-
bioRxiv - Immunology 2019Quote: ... pH 7.4, 150 mM NaCl, 0.25% deoxycholic acid, 1% NP-40 and 0.5% SDS supplemented with protease inhibitor [Roche]) and centrifuged at 12,000 g at 4°C for 10 min ...
-
bioRxiv - Biochemistry 2020Quote: ... the medium was replaced by serum free DMEM supplemented with 1% fatty acid free BSA (Roche Applied Sciences) and a mixture of oleate and palmitate (ratio 2:1 ...
-
bioRxiv - Cell Biology 2021Quote: ... membranes were blocked with 10 mL of 1x blocking solution diluted in 1x Maleic Acid Buffer (Roche, 115857262001) with 0.3% TWEEN 20 for 30 minutes at room temperature ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Total nucleic acids were purified from nasopharyngeal swab samples using a MagNA Pure 96 System (Roche Applied Sciences). All samples were treated with DNase I (Promega ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nucleic acid precipitation was carried on ice in HisA supplemented with 1M LiCl and cOmplete protease inhibitor (Roche) for 10 min ...
-
bioRxiv - Cancer Biology 2023Quote: ... Nucleic acids were UV-crosslinked to the membrane and incubated with prehybridization buffer DIG Easy Hyb (11603558001, Roche,) in a hybridization tube at 37° C for 30 min with rotation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The nucleic acid pellet was resuspended TE buffer and treated with 0.05 µg/µL RNase (Roche Cat# 11119915001) for >15 hr at 37°C ...
-
bioRxiv - Molecular Biology 2020Quote: ... The radiolabeled nucleic acid was recovered by gel-filtration using a Sephadex G-50 fine Quick Spin column (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: ... 0.1 mM ethylene glycol-bis(2-aminoethylether)-N,N,N’,N’-tetraacetic acid (EGTA) and protease inhibitor cocktail (Roche) on ice for 20 min ...
-
bioRxiv - Genetics 2019Quote: ... Next embryos were washed in blocking solution (100mM maleic acid, 150 mM NaCl pH 7.5, 2% blocking reagent (Roche)) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2021Quote: ... in homogenization buffer (320mM sucrose, 5mM sodium pyrophosphate, 1mM EDTA, 10mM HEPES pH 7.4, 200nM okadaic acid, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Physiology 2021Quote: ... Trypsin activity was then inhibited by adding to the homogenate bovine serum albumin (BSA) fatty acid free (0.25 mg/mL) and protease inhibitor cocktail (PIC, Roche).
-
bioRxiv - Cell Biology 2021Quote: ... After addition of the extraction solution containing 1% acetic acid and Complete Mini protease inhibitor cocktail (Roche, Basel, Switzerland) in 1:2 w/v proportion ...
-
bioRxiv - Biophysics 2022Quote: ... either 10 μl of vehicle or 10 μl of S1P at different concentrations in 0.5 %w/v fatty acid-free BSA (10775835001, Roche) solution in PBS was added ...
-
bioRxiv - Microbiology 2022Quote: ... bacteria were washed twice in phosphate buffer saline and resuspended in 7H9 base media + 0.05% tyloxapol + 0.085% NaCl containing either 5g/L or 50g/L of fatty acid free BSA (fraction V Roche) with no glycerol nor dextrose added ...
-
bioRxiv - Neuroscience 2021Quote: ... human iPSC-derived neuronal cultures and N2a cells were collected in Lysis Buffer (50 mm Tris-Base, 150 mm NaCl, 1% Triton X-100, 0.5% deoxycholic acid) with protease inhibitor (Roche) and phosphatase inhibitor cocktails II and III (Sigma ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.1% SDS, 1% deoxycholic acid, 0.5 mM PMSF, 1 mM DTT, 0.1 mM sodium orthovanadate, and Roche protease inhibitors). Nuclear lysates were sonicated with a Branson 250 Sonifier (output 20% ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membranes were incubated in a blocking solution containing maleic acid buffer (pH 7.5) and 1 % blocking reagent (Roche). Subsequently ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was transferred to a blocking buffer (1 M maleic acid solution pH7.4, 1% nucleotide blocking reagent (Roche)) for 30 minutes and then incubated in antibody-solution (anti-dioxigenin-AP fragments in blocking buffer) ...
-
bioRxiv - Microbiology 2023Quote: ... titrated to pH 8.1 with phosphoric acid) with protease and phosphatase inhibitors added (Roche, CO-RO and PHOSS-RO) and sonicated ...
-
bioRxiv - Molecular Biology 2023Quote: ... in complementary deoxyribonucleic acid (cDNA) from 10 ng total RNA in 10 μl reactions with 2× Master Mix (Roche) in a StepOnePlus Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cancer Biology 2021Quote: ... cells were centrifuged and cell killing assessed using the LDH Assay (Roche #11644793001) according to the manufacturers protocol using the SPECTROstar Nano (BMG Labtech).
-
bioRxiv - Genetics 2020Quote: ... Relative qPCR assays were performed using the LightCycler 480 qPCR system from Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2021Quote: ... The proliferation assay was carried out following the manufacturer’s instructions (Roche, Indianapolis, IN) at 24 and 72 hours ...
-
bioRxiv - Immunology 2019Quote: ... Libraries were checked for quality control with KAPA qPCR QC assay (KAPA Biosystems). The libraries (33 total ...
-
bioRxiv - Genomics 2019Quote: ... The library was quantified using a real-time qPCR assay (Lightcycler 480 Roche) with the universal Illumina adapter sequences IS7 and IS8 as targets ...
-
bioRxiv - Physiology 2019Quote: ... Normalized SIRT1 amount was used for activity assays using calf thymus histones (Roche), as indicated below.
-
bioRxiv - Cancer Biology 2021Quote: The thermal stability assay was performed in the Real Time Detection system (Roche). Each pMHC complex was diluted in 10 mM Tris-HCl (pH 8.0) ...
-
Therapeutic base and prime editing of COL7A1 mutations in recessive dystrophic epidermolysis bullosabioRxiv - Bioengineering 2021Quote: ... cellular proliferation was evaluated using a WST-1 assay (05015944001, Roche, Basel, Switzerland). Briefly ...
-
bioRxiv - Plant Biology 2022Quote: ... RT-qPCR assays were carried out on LightCycler LC480 II (Roche Diagnostics, Germany) using SYBR Green Jumpstart Taq Ready mix (Sigma-Aldrich ...
-
bioRxiv - Immunology 2019Quote: ... assays were performed in the presence of 1000 U/mL IL-2 (Roche). Effector-target conjugates were incubated in 200 mL in round-bottom 96-well plates (Corning ...
-
bioRxiv - Pathology 2020Quote: ... Glucose (mmol/L) in serum was measured using the GLUC2 assay from Roche, an enzymatic reference method with hexokinase ...
-
bioRxiv - Pathology 2020Quote: ... Insulin (mU/L) in serum was measured using the INSULIN assay from Roche, a sandwich electrochemiluminescence immunoassay ECLIA on Cobas e 411 (Roche ...
-
bioRxiv - Immunology 2020Quote: ... Quantitative PCR assays were performed using the FastStart SYBR Green Master Mix (Roche) on a Step One Plus Real-Time PCR system (Applied Biosystems ...
-
bioRxiv - Biochemistry 2023Quote: Cytotoxicity was analyzed using the lactate dehydrogenase (LDH) cytotoxicity assay (Roche, Indianapolis, IN). Briefly ...