Labshake search
Citations for Roche :
301 - 350 of 1939 citations for Trefoil Factor 3 TFF3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2019Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics). Color development was allowed to proceed overnight or was stopped after 2-3 hours (for quantification of npba expression in Vs/Vp ...
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
Liver X Receptor activation regulates genes involved in lipid homeostasis in developing chondrocytesbioRxiv - Physiology 2019Quote: ... This was followed by a 1.5-2 hour incubation in Collagenase-P (3 mg/mL, Roche) diluted in Dulbecco’s Modified Eagles Medium (DMEM ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... 5’UTRs and 3’UTRs amplifications were performed using either Expand High Fidelity PCR System (Roche) or KAPA HiFi PCR system (KAPA Biosciences ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Neuroscience 2023Quote: ... and nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 5 hours ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Immunology 2023Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics) for chromogenic detection ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... with nitro blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP) substrate (Roche Diagnostics). The color was allowed to develop for 1 hour (gal) ...
-
bioRxiv - Physiology 2024Quote: ... and visualized using 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium substrate (Roche Diagnostics). After color development for 15 min (gal) ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Genomics 2022Quote: ... The ConA bound nuclei were then incubated with primary antibody diluted 1:100 in Antibody Buffer (20 mM HEPES pH7.5, 150 mM NaCl, 0.5 mM spermidine, Roche Complete Protease Inhibitor Cocktail ...
-
bioRxiv - Cancer Biology 2019Quote: ... washed and incubated with G6B antibody diluted 1:100 in Ventana’s DISCOVERY antibody diluent (Roche Cat#760-108) for 60 minutes at room temperature ...
-
bioRxiv - Immunology 2023Quote: The following antibodies were used for immunoblots and immunoprecipitations: anti-HA as purified antibody or matrix (3F10, Roche), anti-FLAG as purified antibody or matrix (M2 ...
-
bioRxiv - Plant Biology 2020Quote: ... or an anti-HA antibody (3F10; Roche).
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with anti-Digoxigenin antibody (Roche) at 4°C O/N ...
-
bioRxiv - Molecular Biology 2021Quote: ... 2 μg of GFP antibody (Roche 11814460001) was pre-incubated with 50 μl Protein A and Protein G Sepharose (GE Healthcare 17513801 and 17061801 ...
-
bioRxiv - Molecular Biology 2021Quote: ... anti-HA monoclonal antibody (1:2000, Roche), anti-Ataxin 1 (phospho S776 ...
-
bioRxiv - Molecular Biology 2021Quote: ... Antibodies for anti-HA-HRP (3F10, Roche), anti-Smt3 (B ...
-
bioRxiv - Biochemistry 2019Quote: ... functionalized with an anti-digoxigenin antibody (Roche) for 10 minutes at room temperature ...
-
bioRxiv - Cell Biology 2019Quote: ... HRP-conjugated anti-mouse secondary antibody (Roche) and ECL (PIERCE ...
-
bioRxiv - Developmental Biology 2019Quote: ... HRP-conjugated anti-digoxigenin antibody (Roche, 11207733910) or HRP-conjugated anti-dinitrophenol antibody (Perkin Elmer ...
-
bioRxiv - Genetics 2021Quote: Mouse bi-clonal anti-GFP antibody (Roche Diagnostics ...
-
bioRxiv - Biochemistry 2020Quote: ... Flag antibody (1:1000) was from Roche, PP2Ac antibody (1:2000 ...
-
bioRxiv - Plant Biology 2020Quote: ... and incubated with anti-DIG antibody (Roche) for 2 hours at 22 °C ...
-
bioRxiv - Systems Biology 2021Quote: ... A primary antibody recognizing GFP (Roche Diagnostics) and a horseradish peroxidase-conjugated secondary antibody (Southern Biotech ...
-
bioRxiv - Neuroscience 2020Quote: ... at 2μg/ml (antibody diluent, Roche, Switzerland). The staining was completed with the Ventana XT DABMap kit and a haematoxylin counterstain ...
-
bioRxiv - Cell Biology 2021Quote: ... GFP antibodies from Roche (11814460001, 1:2000), tubulin from Sigma (T61999 ...
-
bioRxiv - Cell Biology 2021Quote: ... Mouse anti-GFP monoclonal antibody (Roche, 11814460001) was covalently coupled to magnetic beads at 12 μg antibody per 100 μL Dynabeads Protein A (ThermoFisher) ...
-
bioRxiv - Microbiology 2021Quote: ... mouse anti-HA antibody (Roche; 1:1000), rabbit-anti-γH2A.X antibody (Cell signaling cat # 9718S ...
-
bioRxiv - Cell Biology 2021Quote: ... coupled with anti-GFP antibodies (Roche, 11814460001) or anti-Mad1 antibodies (Heinrich et al. ...
-
bioRxiv - Cell Biology 2022Quote: ... bound to anti-Myc antibody (Roche, 9E10) for 2 h at 4 °C ...
-
bioRxiv - Biochemistry 2022Quote: ... anti-GFP mouse monoclonal antibody (Roche Diagnostics), anti-tubulin α mouse monoclonal antibody (Merck Chemicals GmbH) ...
-
bioRxiv - Neuroscience 2022Quote: ... anti-Digoxigenin-AP coupled antibody (Roche Diagnostics) and sheep serum diluted to 2.5% with 1xPTW for 36-40h at 4°C ...