Labshake search
Citations for Roche :
551 - 600 of 1939 citations for Trefoil Factor 3 TFF3 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2020Quote: ... These pieces were then added to 3-4 ml of digestion media containing 0.1 mg/ml Liberase (Roche, 501003280), 100 U/ml DNase I (Sigma ...
-
bioRxiv - Plant Biology 2021Quote: ... in paraffin-embedded sections (8µm) and color was detected with 5-bromo-4-chloroindol-3-yl phosphate/nitrateblue tetrazolium (BCIP/NBT) (Roche).
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... Myelin was washed by dilution in HBSS and centrifuged at 400 x g for 5 min at 4 °C before suspending in 3 mL ice cold 0.32 M sucrose solution containing protease inhibitor cocktail (Roche). Next ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mL of Tris (pH = 8.5) and 3 tablets each of the protease/phosphatase inhibitors PhosStop and Complete Mini (Roche). Tissues were then lysed in Precellys Homogenizer Bertin (program 6 x 20s pulse ...
-
bioRxiv - Neuroscience 2023Quote: ... Cells were transfected according to the manufacturer’s protocol at a µL lipofectamine: µg plasmid ratio of 3:1 (X-tremeGENE 9, Roche). After 48 hours ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Molecular Biology 2022Quote: Dried peptides were re-dissolved in 212 µL of pyro-glu buffer (16 mM NaCl, 0.5 mM EDTA, 3 mM cysteamine and 50 μM aprotinin (Roche)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were first mechanically dissociated with a scalpel into approximately 1-3 mm pieces and enzymatically digested in RPMI-1640 medium (Cytiva) containing 0.25 mg/ml DNase I (Roche) and 0.25 mg/ml Collagenase (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA (3–4 μg) was used to prepare cDNA with the Transcriptor First-Strand cDNA synthesis kit (Roche). qPCR was performed with TaqMan gene expression assay primers (Thermo Fisher Scientific ...
-
bioRxiv - Physiology 2023Quote: ... or 50 Tris-HCl pH 7.5, 1 phenylmethylsulfonyl fluoride, 3% SDS (RyR, SERCA, CaMKIIδ-C273S) and supplemented with cOmplete protease inhibitor (Roche). Lysates were then incubated on ice for 15 min and centrifuged for 15 min at 15000 rcf at 4°C ...
-
bioRxiv - Molecular Biology 2023Quote: ... pellets were resuspended in 100 μl of lysis buffer (50 mM Tris, pH 7.5, 1 mM EDTA, 3 mM DTT, and 1X cOmplete protease inhibitor cocktail [11836145001, Roche]) and lysed on a beadbeater for 5 min at room temperature with 100 μl of acid-washed glass beads ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM magnesium chloride) supplemented with 1 cOmplete protease inhibitor cocktail tablet per 50 ml of lysis buffer (Roche) and mechanically disrupted in a Dounce homogenizer ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 million cells were pre-extracted on ice with ice-cold 30 µl CSK buffer (25 mM HEPES pH 7.4, 50 mM NaCl, 1 mM EDTA, 3 mM MgCl2, 300 mM sucrose, 0.2% Triton X-100, 1 Roche cOmplete protease inhibitor cocktail tablet per 50 ml of buffer ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysates were clarified by centrifugation and then incubated with primary antibodies or HA antibody conjugated beads (HA beads, Roche Applied Bioscience) overnight at 4°C ...
-
bioRxiv - Biochemistry 2020Quote: ... and the presence of enzymes were confirmed by immunoblot using the anti-His6 antibody conjugated to peroxidase (BMG–His-1 monoclonal antibody) (Roche, Mannheim, Germany).
-
bioRxiv - Plant Biology 2020Quote: ... A monoclonal anti-GFP antibody (Roche, cat. no. 11814460001) was used at 1:3000 dilution and combined with a 1:20000 rabbit anti-mouse secondary antibody (Agrisera ...
-
bioRxiv - Plant Biology 2020Quote: ... samples were treated with anti-digoxygenin (DIG) antibody (Roche) and signals were detected using NBT/BCIP (Promega) ...
-
bioRxiv - Biophysics 2021Quote: ... Primary antibodies were: rat-anti-HA (1:5,000; Roche Applied Science catalog ...
-
bioRxiv - Cell Biology 2020Quote: ... anti-GFP antibody 13.1 + 7.1 (Roche, Merck, Darmstadt, Germany) or anti-CSP repeat antibody – mAB 3D11 (Yoshida et al. ...
-
bioRxiv - Developmental Biology 2020Quote: ... Anti-DIG alkaline phosphatase antibody (Roche Diagnostics, Basel, Switzerland) was used for detection ...
-
bioRxiv - Developmental Biology 2020Quote: ... incubated with alkaline phosphatase-conjugated anti-DIG antibody (Roche) in 1% BSA in MABT at 4 degree for overnight ...
-
bioRxiv - Neuroscience 2021Quote: ... and mouse anti-GFP antibody (1:500, Roche, RRID:AB_390913) diluted in TNB was added to each slide under a bridged coverslip and incubated at 4°C overnight ...
-
bioRxiv - Molecular Biology 2021Quote: ... then blotted with mouse anti-GFP antibody (Roche 11814460001) and anti-mouse-HRP secondary (Cell Signaling 7076) ...
-
bioRxiv - Neuroscience 2021Quote: ... and 1 uL of anti-GFP antibody (Roche 11814460001) were used to pull down DMA-1::GFP and KPC-1::GFP overnight at 4C ...
-
bioRxiv - Molecular Biology 2020Quote: ... A monoclonal mouse anti-GFP antibody (Roche, Nr. 11814460001) was used to detect ENDU-2::EGFP in the gonad.
-
Proteasome granular localization is regulated through mitochondrial respiration and kinase signalingbioRxiv - Cell Biology 2022Quote: ... Antibodies used were anti-GFP (1:500; Roche, #11814460001), and anti-Pgk1 (1:10,000 ...
-
bioRxiv - Cell Biology 2019Quote: ... The anti-c-Myc antibody was purchased from Roche. Restriction enzymes and Gibson assemble master mix was purchased from New England Biolabs ...
-
bioRxiv - Plant Biology 2019Quote: ... membranes were probed with ∝-HA antibody (Roche, Indianapolis, IN) conjugated with HRP.
-
bioRxiv - Pathology 2020Quote: ... Then incubated in Universal secondary antibody (Roche Diagnostics KK) for 20 min at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... probed with alkaline phosphatase-labeled anti-digoxigenin antibody (Roche) and washed with 1x TBS-T ...
-
bioRxiv - Neuroscience 2020Quote: ... Primary antibodies: rat anti-HA (Roche 11867431001, 1:500), mouse anti-HA (Biolegend 901501 ...
-
bioRxiv - Neuroscience 2021Quote: ... or anti-fluorescein antibody conjugated with POD (Roche, 11426346910) at 40C ...
-
bioRxiv - Neuroscience 2020Quote: ... An anti-DIG antibody conjugated with alkaline phosphatase (Roche) was used to probe sections ...
-
bioRxiv - Neuroscience 2019Quote: ... Anti-DIG antibody conjugated to HRP (1:2000, Roche) were applied for 2 hours at RT ...
-
bioRxiv - Biochemistry 2020Quote: ... Anti-HA HRP-conjugated antibody was ordered from Roche.
-
bioRxiv - Biochemistry 2020Quote: Antibodies and their sources were: anti-HA (Roche, 15645900), anti-Cdc48 (own production) ...