Labshake search
Citations for Roche :
151 - 200 of 6336 citations for SpectraDye Antibody Labeling Kit 350 since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... The cells were stained using terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL apoptosis assay kit, Roche, American), and the cells were viewed under a fluorescence microscope.
-
bioRxiv - Developmental Biology 2023Quote: Digoxigenin-labeled cRNA probes were prepared via in vitro transcription (DIG RNA labeling kit; Roche Diagnostics, Basel, Switzerland) from the Prokr2 template available from Genepaint (https://gp3.mpg.de/viewer/setInfo/MH1790/12) ...
-
bioRxiv - Developmental Biology 2022Quote: ... Both probes were labeled with fluorescein or digoxigenin (DIG) using RNA labeling kit (Roche Applied Science, Mannheim, Germany). The heads of fish at 4 mpf were fixed in 4% paraformaldehyde (PFA ...
-
bioRxiv - Developmental Biology 2023Quote: ... In vitro transcription of Digoxigenin/Fluorescent-labeled probes was performed using an RNA Labeling Kit (Roche Diagnostics Corporation) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2023Quote: ... An HBV RNA probe and GAPDH RNA probe were linearized and synthesized by digoxigenin RNA labeling kit (Roche). Hybridization and detection were performed using the DIG Northern Starter kit (Roche ...
-
Evolutionary conserved aspects of animal nutrient uptake and transport in sea anemone vitellogenesisbioRxiv - Evolutionary Biology 2022Quote: ... and labeled with DIG RNA Labeling Mix (Roche) using previously published protocols74.
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... with a digoxigenin (DIG)-labeling mix (Roche Diagnostics). Sense probes corresponding to each antisense probe were also synthesized as controls.
-
bioRxiv - Neuroscience 2019Quote: ... and a DIG RNA labeling mix (Roche 11277073910) using manufacturer protocols ...
-
bioRxiv - Developmental Biology 2023Quote: ... T7 polymerase and biotin labeling mix (Roche #11685597910) were used according to the package directions ...
-
bioRxiv - Developmental Biology 2023Quote: ... 1X DIG RNA labeling mix (Roche, Cat 11277073910), 1 U/μL RNAse inhibitor (Thermo Scientific ...
-
bioRxiv - Developmental Biology 2024Quote: ... and a digoxigenin labeling mix (Roche, catalog#: 11277073910). The synthesized riboprobes were treated with DNase I digestion to remove the DNA template ...
-
bioRxiv - Cell Biology 2024Quote: ... and Digoxigenin-UTP (DIG RNA Labeling Mix, Roche): mmp14b Fwd ...
-
bioRxiv - Developmental Biology 2019Quote: ... The digoxigenin-labeled RNA probes were prepared using a DIG RNA labeling kit according to the manufacturer’s protocol (Roche) using each cDNA clone as the template ...
-
bioRxiv - Molecular Biology 2022Quote: Southern blot analysis was performed using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche 11585614910) and the DIG Wash and Block Buffer Set (Roche 11585762001) ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIG-labeled probes where generated using T7/SP6 transcriptions start sites and the digoxigenin RNA Labeling Mix kit (Roche) after manufactures instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... Expressed sequence tags (ChESTs; SourceBioScience) were used to generate in situ probes using a DIG RNA labeling kit (Roche). In situ hybridization was performed as described (Mauti et al. ...
-
bioRxiv - Developmental Biology 2022Quote: Apoptosis in the migrating primordium was identified using terminal transferase-mediated dUTP nick end-labeling (TUNEL) assay according to manufacturer’s instruction with minor modifications (In situ Cell Death Detection Kit, TMR Red, Roche). Embryos at 30-42 hpf were dechorionated and fixed in 4% PFA overnight at 4°C ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Synthetic Biology 2020Quote: ... Washing and detection steps were carried out as outlined in the manufacturer’s protocol for the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche).
-
bioRxiv - Genetics 2020Quote: ... Southern blot was performed according to the manufacturer’s protocol of DIG HIGH prime DNA labeling and detection starter kit 1 (Roche). 10 µg aliquot of genomic DNA was digested overnight with DraIII ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Detection of the respective bands was carried out by the Dig DNA labeling and detection kit (Roche, Penzberg, Germany) according to the manufacturers instructions.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Antisense Digoxygenin-UTP riboprobes were synthesized using SP6 or T7 RNA polymerases and the DIG RNA Labeling kit (Roche).
-
bioRxiv - Neuroscience 2021Quote: ... antisense and sense digoxogenin (DIG)-labeled RNA probes were generated using the DIG RNA labeling kit (Roche Diagnostics, Germany), following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... were produced with DIG-UTP by in vitro transcription using the Sp6 and T7 promoters according to the manufacturer’s protocol (RNA-labeling kit; Roche). The sections were treated as follows ...
-
bioRxiv - Neuroscience 2022Quote: ... Antisense and sense single-strand riboprobes were transcribed in vitro using DIG or FITC RNA labeling kit (Roche Diagnostics). cRNA probes for Gad155 and Slc17a756 were used.
-
bioRxiv - Developmental Biology 2023Quote: ... We synthesized digoxigenin (DIG)-labeled sense and antisense RNA probes using a DIG RNA Labeling Kit (Roche, Basel, Switzerland) after digestion with the appropriate restriction enzymes BamHⅠ-HF ...
-
bioRxiv - Developmental Biology 2024Quote: ... and used to produce the DIG-labeled single-stranded RNA probes using the DIG RNA labeling kit (Roche, #11175025910). Probes were then cleaned with MegaClear Kit (Thermo Fisher ...
-
bioRxiv - Plant Biology 2024Quote: ... 1 μg of the PCR product was used for RNA probe labeling with T7 RNA polymerase as per the DIG Northern Starter Kit’s Instruction Manual (Roche). Post-hybridization washes and immuno-chemiluminescent detection of the bound probe were conducted following the instructions provided in the DIG Northern Starter Kit manual (Roche) ...
-
bioRxiv - Microbiology 2019Quote: ... and labeled with Biotin RNA Labeling Mix (Roche, 11685597910). The synthesized RNA was treated with Rnase-free DNase I (Thermo ...
-
bioRxiv - Developmental Biology 2022Quote: ... and DIG RNA Labeling Mix (Roche, Cat. No. 11277073910).
-
bioRxiv - Molecular Biology 2021Quote: ... and biotin (Biotin RNA Labeling Mix 10 × conc, Roche) were in vitro transcribed using in vitro Transcription T7 Kit (Takara) ...
-
bioRxiv - Developmental Biology 2019Quote: ... and DIG RNA Labeling Mix (Roche, Cat. No. 11277073910). Anti-Digoxigenin-POD Fab fragment (Roche ...
-
bioRxiv - Genomics 2019Quote: ... in the presence of Biotin RNA labeling mix (Roche). The primers used were listed in Supplementary Table 3.
-
bioRxiv - Microbiology 2022Quote: ... and Fluorescein RNA Labeling Mix (11685619910, Roche, Basel, Switzerland). To induce germination ...
-
bioRxiv - Neuroscience 2022Quote: ... or Fluorescein RNA Labeling mix (Roche Applied Science, #11685619910) and T3 polymerase (Roche Applied Science ...
-
bioRxiv - Molecular Biology 2022Quote: ... or biotin (Biotin RNA Labeling Mix 10 × conc, Roche) were transcribed using in vitro Transcription T7 Kit (Takara) ...
-
bioRxiv - Microbiology 2022Quote: ... Target probes were prepared using chemiluminescent DIG-labeling (Roche); see SI Appendix ...
-
bioRxiv - Developmental Biology 2024Quote: ... or Fluorescein RNA labeling mix (Roche, Cat. No. 11685619910) together with T7 RNA polymerase (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... rehydrated sections were incubated with TUNEL labeling mix (Roche) at 37°C for 1 hour ...
-
bioRxiv - Neuroscience 2019Quote: Amplified DNA fragments were cloned into the pBSK backbone and transcribed with T3 RNA polymerase using DIG RNA Labeling Mix and Fluorescein RNA Labeling Mix according to the manufacturer protocol (all from Roche Diagnostics, Mannheim, Germany).
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Developmental Biology 2021Quote: ... was used as the template to create the Scx mRNA probe by utilizing the DIG RNA Labeling Kit Catalog #11175025910 (Roche) and the T3 RNA polymerase Catalog #11031163001 (Roche) ...
-
bioRxiv - Cell Biology 2020Quote: The RNA probes were transcribed with the T7 polymerase and labeled using the DIG RNA labeling kit (Roche Cat # 11175025910). After the labeling reaction was complete ...
-
bioRxiv - Developmental Biology 2021Quote: ... RNA probes were created from in vitro transcription of PCR products carrying the T7 RNA polymerase recognition sequence at one end and synthesized by using a digoxigenin (Dig)-labeling kit (Roche). Wing discs of L3 larvae were hybridized with probes overnight at 56 °C using standard procedures and visualized using anti-Dig-AP (1:1,000 ...
-
bioRxiv - Developmental Biology 2021Quote: ... Digxigenin (DIG)-labeled sense and antisense probes were performed from the linearized pGEM-T-easy plasmids using the DIG RNA Labeling Kit (Roche).
-
bioRxiv - Molecular Biology 2021Quote: ... and detection were performed with a DIG High Prime DNA Labeling and Detection Starter Kit (Roche Applied Science, Penzberg, Germany).
-
bioRxiv - Molecular Biology 2020Quote: ... and detection were performed with a DIG High Prime DNA Labeling and Detection Starter Kit (Roche Applied Science, Penzberg, Germany). Total RNA was isolated from frozen fungal mycelia using an RNA extraction kit (Megan ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Cancer Biology 2019Quote: RNA sense and anti-sense probes were synthesized from pcsDest2-gdf6a and pcsDest2-gdf6b constructs using DIG RNA Labeling Kit (Roche) per the manufacturer’s instruction ...
-
bioRxiv - Developmental Biology 2019Quote: ... Antisense DIG-labelled eiger RNA probe was prepared from XhoI-linearized pBSK-eiger plasmid using T3 RNA polymerase (DIG RNA Labeling Kit, Roche) and detected with the DIG Nucleic Acid Detection Kit (Roche) ...