Labshake search
Citations for Roche :
1 - 50 of 758 citations for Recombinant Rabbit TNF Protein since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... The recombinant murine TNF-α used was from Roche.
-
bioRxiv - Biochemistry 2023Quote: ... Cells were then stimulated with recombinant murine TNF-α (Roche) at 70-80% cell confluency ...
-
bioRxiv - Systems Biology 2021Quote: Recombinant proteins were purified using the Anti-Protein C Affinity Matrix (11815024001, Roche) on an ASPEC liquid handling instrument (Gilson) ...
-
bioRxiv - Immunology 2023Quote: ... and specific primers (tnf fwd TGTCTTTGAGATCCATGCCGT; tnf rev TCAAAATTCGAGTGACAAGCCTG) were used on LightCycler 480 (Roche). The reactions were performed in triplicates and the results were analyzed with qbase+ software ...
-
bioRxiv - Cell Biology 2024Quote: ... Quantitative Western blot analysis was employed to determine concentration of recombinant protein using a recombinant GFP standard (Roche, 11814524001) with a defined concentration of 1 mg/ml ...
-
bioRxiv - Genetics 2022Quote: ... MYC-tagged or FLAG-tagged recombinant proteins were captured using ~5μg antibody and Protein-Agarose beads (Roche Applied Science, 11243233001) according to the manufacturer’s protocol ...
-
bioRxiv - Bioengineering 2021Quote: ... pastoris culture medium containing the recombinant protein was purified by affinity chromatography Ni-NTA agarose (Roche).
-
bioRxiv - Evolutionary Biology 2021Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 594 fluorophores (dilution 1:200 ...
-
bioRxiv - Cell Biology 2022Quote: ... HA-epitope tagged recombinant proteins were detected using a rat-derived monoclonal anti-HA antibody (dilution 1:200, Roche) followed by a secondary anti-rat antibody coupled to AlexaFluor 488 fluorophores (dilution 1:200 ...
-
bioRxiv - Immunology 2019Quote: ... human recombinant IL-2 (Roche) was also added fresh immediately prior to use at a final concentration of 100 IU/ml ...
-
bioRxiv - Molecular Biology 2022Quote: Recombinant HBsAg (Roche Diagnostics International) was used as a marker for aerosol formation ...
-
bioRxiv - Synthetic Biology 2022Quote: ... with recombinant DNase I (Roche) treatment ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and recombinant proteinase K (Roche). Samples were run on a 1% certified megabase agarose (Bio-Rad ...
-
bioRxiv - Biochemistry 2021Quote: ... the recombinant protein was expressed in HEK293T cells and released by 100 μM digitonin in PBS with protease inhibitor cocktail (Roche). The cell lysate prepared with the same method from HEK293T was used as the negative control.
-
bioRxiv - Immunology 2022Quote: ... recombinant human IFNγ from Roche (#11040596001), recombinant human IL-1β from PeproTech (#200-01B).
-
bioRxiv - Microbiology 2021Quote: ... Recombinant IFN-α2a (Roferon L03AB04, Roche) and IFN-λ1 (Peprotech 300-02L ...
-
bioRxiv - Immunology 2022Quote: ... DNAse I recombinant (Roche by Sigma Aldrich) and sodium pyruvate (Sigma Aldrich) ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...
-
bioRxiv - Molecular Biology 2019Quote: ... 0.02 U/ml DNaseI (recombinant DNaseI, Roche), 20 mg/ml leupeptin ...
-
bioRxiv - Immunology 2023Quote: ... 100 units/mL recombinant IL-2 (Roche), and 5 μg/mL PHA (Sigma) ...
-
bioRxiv - Immunology 2021Quote: ... 10 ng/ml recombinant human EGF (Roche, Ireland), 1 μg/ml hydrocortisone (Sigma ...
-
bioRxiv - Cell Biology 2021Quote: ... supplemented with recombinant DNASE I (1000 U) (Roche, 0453628001), cOmplete protease EDTA-free inhibitor cocktail (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by the treatment with recombinant DNase I (Roche). 1 µg of the obtained RNA was used for cDNA synthesis using Superscript III (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin-2 (20U/ml; Hoffmann-La Roche). Fresh medium containing IL-2 was added twice per week ...
-
PSGL-1 inhibits HIV-1 infection by restricting actin dynamics and sequestering HIV envelope proteinsbioRxiv - Microbiology 2020Quote: ... and human recombinant IL-2 (30 U/ml, Roche) for 72 h.
-
bioRxiv - Immunology 2023Quote: ... and 10 ng/ml recombinant human IL-2 (Roche). For activation of murine CD4+ T cells ...
-
bioRxiv - Immunology 2023Quote: ... and 50 ng/mL recombinant DNase I (Roche Diagnostics) in PBS ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... DNase I recombinant RNase free was purchased from Roche Life Sciences (Germany).
-
bioRxiv - Cell Biology 2021Quote: ... and mouse/rabbit IgG overnight at 4°C and further with protein G-coupled agarose beads (ROCHE) for 1-2 h ...
-
bioRxiv - Immunology 2023Quote: ... 100 IU/ml of recombinant human IL-2 (Roche Diagnostics) or 10 μg/ml of SIVmac251 Env gp130 (ImmunoDx) ...
-
bioRxiv - Microbiology 2020Quote: ... and recombinant interleukin (IL)-2 (20U/ml; Hoffmann-La Roche, Italy). Cells without peptide stimulation and anti-CD3-stimulated (1μg/ml ...
-
bioRxiv - Immunology 2020Quote: ... supplemented with 20 U/ml of recombinant huIL-2 (Roche, 11147528001) and then plated into 12 well plates previously coated for 2 hours RT with 1 μg/ml of huCD28.2 (BioLegend ...
-
bioRxiv - Microbiology 2022Quote: Removal of DNA was conducted with Recombinant DNase I (Roche Diagnostics) per the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: 2 μl 1x proteinase K (recombinant PCR Grade, 25 mg - Roche) dissolved in 2,5 ml TE (10 mg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µg of RNA was treated with Recombinant DNase I (Roche) and cDNA was synthesized using Superscript IV reverse transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Tissue was incubated with 100 μL of recombinant Proteinase K (Roche) diluted to ∼2 mg/mL in 1 x tris-EDTA (TE ...
-
bioRxiv - Pharmacology and Toxicology 2019Quote: The recombinant biotinylated A33-His antigen was immobilized on streptavidin (StreptaWells, Roche) or avidin coated wells (Avidin ...
-
bioRxiv - Biochemistry 2020Quote: ... transfected with recombinant EMBacY BACs using X-tremeGENE DNA Transfection Reagent (Roche), and incubated for 72 h at 28 °C ...
-
bioRxiv - Systems Biology 2020Quote: ... The tissue was digested with Liberase Blendzyme 3 recombinant collagenase (Roche Diagnostics) according to the manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and treated with DNAse I (Dnase I recombinant RNAse-free, Roche Diagnostics). Then cDNA were produced from 5 μL of total RNA using RT Superscript III (RT Superscript III First Strand cDNA Synthesis Kit ...
-
bioRxiv - Cell Biology 2020Quote: ... Genomic DNA was removed by digestion using DNase I Recombinant (Roche, 04716728001) and RiboLock RNase Inhibitor (Thermo Scientific ...
-
bioRxiv - Plant Biology 2022Quote: ... Recombinant baculovirus was generated by initial lipofection with Xtreme gene reagent (Roche) of Sf21 insect cells (Invitrogen) ...
-
bioRxiv - Neuroscience 2022Quote: ... and basic fibroblast growth factor (bFGF, 10 ng/ml; recombinant bovine, Roche). The cells were then plated in a 96-well plate in complete neurosphere medium containing DMEM/F-12 EGF and bFGF ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1x DNase buffer (500ul) and 200U recombinant DNase I (20ul, Roche, 04716728001) at 37 C in a shaker set at 100 RPM ...
-
bioRxiv - Cancer Biology 2022Quote: ... DNA contamination was removed through treatment with recombinant DNaseI (Roche Diagnostics, #04716728001) for 15 minutes at RT and column purification using Qiagen RNeasy Mini kit (#74106) ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA contaminations were eliminated with DNase I recombinant (#04716728001; Roche Applied Science) following the manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... 50μM beta-mercaptoethanol and 10 ng/ml recombinant human IL-2 (Roche). Both human and murine CD4+ T cells were cultured for 46 hrs under humidified conditions at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... the supernatant was incubated with 5% v/v pre-immune rabbit sera and 20 μl of protein G-beads (Roche) for 1 h on a rotator at 4°C ...
-
bioRxiv - Plant Biology 2020Quote: ... 4 µg recombinant NAA50 was incubated with 100 µM Acetyl-Coenzyme A (Roche) in a 2X acetylation buffer (50mM Tris HCl pH 7.5 ...
-
bioRxiv - Developmental Biology 2022Quote: ... The extracted RNA was then treated with DNase I recombinant RNase free (Roche) and the reverse transcription was done using the Super-Script IV (Invitrogen ...