Labshake search
Citations for Roche :
451 - 500 of 560 citations for Recombinant Human Membrane Metallo Endopeptidase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... Membranes were immunoblotted for 1 hr at 22°C using the following antibodies: rat anti-HA (1:3000; Roche), mouse anti-V5 (1:5000 ...
-
bioRxiv - Cell Biology 2021Quote: ... transferred to PVDF membranes (Amersham Hybond) and probed with following antibodies: mouse anti-HA-HRP (1:1000) (12013819001, Roche) rabbit anti-EMC6 (1:300 ...
-
bioRxiv - Molecular Biology 2022Quote: ... The gel was briefly rinsed with 1 x TBE and RNA was transferred to positively charged Nylon membrane (Roche) using Fastblot (Biometra ...
-
bioRxiv - Cell Biology 2022Quote: ... The protein lysate was electrophoresed into 6-10% SDS-PAGE gels and transferred to a PVDF membrane (Roche, 03010040001). After blocking with 5% BSA ...
-
bioRxiv - Microbiology 2020Quote: ... separated by electrophoresis in a 0.8% agarose gel and transferred onto a nylon membrane (Hybond N+, Roche Molecular Biochemicals). The membrane was hybridized with digoxigenin-labeled DNA probes synthesized with a PCR DIG probe synthesis kit (Roche Molecular Biochemicals ...
-
bioRxiv - Immunology 2020Quote: ... the pellet was resuspended in 50 mL membrane wash buffer supplemented with 1X protease inhibitor (Roche cat no. 04693159001) and 10mg/mL lysozyme and let shake on ice for 30 minutes before sonication at 70% amplitude ...
-
Toxoplasma GRA15 limits parasite growth in IFNγ-activated fibroblasts through TRAF ubiquitin ligasesbioRxiv - Immunology 2020Quote: ... The membrane was blotted overnight at 4°C with rat antibody against the HA tag (Roche, 1/500 dilution), TRAF2 and TRAF6 rabbit antibodies (Suppl ...
-
bioRxiv - Developmental Biology 2022Quote: ... Transfer membranes were then incubated with a 1:10,000 dilution of primary mouse anti-6xHis antibody (Roche, cat. #11922416001) for 1 h ...
-
bioRxiv - Microbiology 2021Quote: ... The membrane was incubated with gentle rocking in DIG Easy Hyb solution (Roche Cat. No. 11 796 895 001) at the respective probe hybridisation temperature (Thyb ...
-
bioRxiv - Developmental Biology 2022Quote: ... The membranes were incubated in a blocking solution containing maleic acid buffer (pH 7.5) and 1 % blocking reagent (Roche). Subsequently ...
-
bioRxiv - Neuroscience 2022Quote: ... the membranes were incubated overnight at 4° C on a rotator with primary antibody in Western Blocking Reagent (Roche), if not stated otherwise ...
-
bioRxiv - Molecular Biology 2023Quote: ... membranes were incubated overnight at 4°C with monoclonal mouse anti-GFP antibody (Roche; Basel, CH; dilution 1:500) or monoclonal rat anti-HA antibody (Roche ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was transferred to a blocking buffer (1 M maleic acid solution pH7.4, 1% nucleotide blocking reagent (Roche)) for 30 minutes and then incubated in antibody-solution (anti-dioxigenin-AP fragments in blocking buffer) ...
-
bioRxiv - Cell Biology 2023Quote: ... the membranes were blocked using non-fat dry milk and stained with an anti-GFP primary (Roche; 1:1000) and a goat anti-mouse secondary antibody coupled to horseradish peroxidase (HRP ...
-
bioRxiv - Pathology 2023Quote: ... Approximately 30-50 μg of proteins were separated by 10% SDS-PAGE and transferred onto a PVDF membrane (Roche). The membrane was blocked with 5% non-fat milk in PBS for 1 h at room temperature and then incubated with the specific primary antibodies at 4°C overnight ...
-
bioRxiv - Molecular Biology 2024Quote: ... membrane hybridization and detection were performed using DIG-High Prime DNA Labelling and Detection Starter Kit II (Roche, #11585614910) as per the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2023Quote: ... the membrane was incubated with 1 nM DIG (Digoxigenin)-labeled Telomere probes in Hybridization solution (DIG Easy Hyb, Roche) at 42°C ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Microbiology 2020Quote: ... Southern blotting was carried out using Hybond-N+ membrane (Amersham) and DIG High Prime DNA Labeling and Detection Starter kit II (Roche), following the indications of the manufacturer ...
-
bioRxiv - Microbiology 2019Quote: ... The membrane was equilibrated in hybridisation buffer for 1 hour at 68°C in pre-warmed DIG Easy Hyb solution (Roche) in a rotating hybridisation oven ...
-
bioRxiv - Cell Biology 2020Quote: ... the membranes were hybridized overnight at 40°C with digoxigenin (DIG)-labeled DNA probes in DIG Easy Hyb solution (Roche). After low and high stringency washes ...
-
bioRxiv - Microbiology 2020Quote: ... Membranes was incubated secondary antibody for an hour in 5% milk and developed using Lumi-light western blot substrate (Roche) to detect HRP ...
-
bioRxiv - Cell Biology 2022Quote: ... From each cell lysate 10 µg of protein were loaded to an SDS-Page (10 % self-made gel) and then blotted to a PVDF western blot membrane (Ref: 3010040001, Roche). The membrane was incubated with rabbit monoclonal antibody against total ERK (Ref ...
-
bioRxiv - Molecular Biology 2022Quote: ... was run on a 15% polyacrylamide gel containing 7M urea and 10 µg/ml APM and then transferred to positively charged nylon membranes (Roche). Pre-hybridization and hybridization steps were performed with Dig Easy Hyb (Roche) ...
-
bioRxiv - Plant Biology 2022Quote: GFP was detected on the membranes using anti-GFP mouse-IgG monoclonal (clones 7.1 and 13.1) antibody (Roche, Basel, Switzerland) in a 1/500 dilution in 5% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... The membrane was hybridized with digoxigenin-labeled DNA probes synthesized with a PCR DIG probe synthesis kit (Roche Molecular Biochemicals) as recommended by the supplier ...
-
bioRxiv - Microbiology 2021Quote: ... Membranes were blocked in TBST with 5% milk protein and probed with the following antibodies: 1:1000 anti-HA (Roche), then 1:1500 goat anti-rat IgG-HRP (Dako) ...
-
bioRxiv - Microbiology 2021Quote: ... release into growth medium (as direct indicator of cell membrane integrity loss) was performed with the Cytotoxicity Detection KitPLUS (Roche) according to the supplier’s manual.
-
CRISPR-Csx28 forms a Cas13b-activated membrane pore required for robust CRISPR-Cas adaptive immunitybioRxiv - Biochemistry 2021Quote: ... The membrane fraction was resuspended in membrane resuspension buffer (50 mM sodium phosphate buffer, 300 mM NaCl, 5% glycerol, EDTA-free protease inhibitor (Roche), 2% DDM ...
-
bioRxiv - Developmental Biology 2021Quote: ... An equal amount of each protein sample was electrophoresed on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred onto polyvinylidene difluoride (PVDF) membranes (3010040001; Roche). The membrane was blocked with 5% non-fat dry milk for 2 hours at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... and proteins were transferred to an activated (100% ethanol, 1 min; followed by two washing steps with water) PVDF membrane (Roche Diagnostics GmbH ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids were spotted (for dot-blot) or electro transferred (for northern-blot) to positively-charged nylon membranes (Roche Diagnostics), and hybridized with DIG-labeled full-length riboprobes as previously described [8 ...
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acids were spotted (for dot blotting) or electro-transferred (for Northern blot) to positively-charged nylon membranes (Roche Diagnostics), and hybridized with DIG-labeled riboprobes as previously described (22).
-
bioRxiv - Microbiology 2023Quote: ... and the membrane was treated with the DIG-High Prime DNA Labeling and Detection Starter kit II (Roche, Basel, Switzerland) according to the manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... The membrane was then washed and incubated 1 hs at RT with goat anti-mouse secondary antibody conjugated to HRP (Roche) at 1/20000 dilution in PBST - 5% milk.
-
bioRxiv - Plant Biology 2023Quote: ... membranes were blocked with 5% skim milk and then incubated in the primary anti-GFP mouse monoclonal antibody (Roche, 11814460001), followed by goat anti-mouse HRP conjugate (BioRad ...
-
bioRxiv - Biochemistry 2024Quote: ... the proteins were transferred to a PVDF membrane and immunodetected with an anti-Myc-HRP antibody (Myc-HRP, 1:5000, Roche). The remaining 10% of the immunoprecipitated samples together with 50 μg of the input were subjected to the same procedure but probed with an anti-GFP antibody (JL-8 ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Microbiology 2020Quote: Damage to the human colon epithelial cell line HT-29 was assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of the LDH enzyme in the growth medium ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...