Labshake search
Citations for Roche :
401 - 450 of 2327 citations for Recombinant Human Epithelial Cell Adhesion Molecule His tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Between 50 and 100 ng of RNA was used as input for the KAPA RNA HyperPrep Kit with RiboErase (Human/Mouse/Rat) library preparation (Roche) on an automated liquid handling platform (Beckman Coulter) ...
-
bioRxiv - Immunology 2023Quote: K2 cells or human neutrophils were lysed with 150-200 µl of lysis buffer (supp. Table 2) supplemented with 1X complete inhibitor (Roche) and incubated for 10 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: Frozen brain tissues from human and animals were used to prepare 10% (w/v) homogenates in RIPA buffer containing PI and PhosStop (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Cell Biology 2020Quote: Whole cells were lysed in 1X Cell Lysis Buffer Cell (Cell Signalling) supplemented with cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). Protein concentration was determined by the Bradford assay using the Bradford reagent (Biorad ...
-
bioRxiv - Immunology 2022Quote: ... The normalization of DNA amount was performed by quantifying albumin gene copies with qPCR using human genomic DNA (20 ng/µl) standard (Roche, #11691112001) as we previously described16.
-
bioRxiv - Microbiology 2019Quote: ... while all other specific primers were designed to be compatible with the Human Universal Probe Library set (90 probes, octamer, Roche Diagnostics) (Supplementary Table 9 ...
-
bioRxiv - Immunology 2019Quote: ... the wells were washed five times and incubated with 100 µl/well goat anti-human IgG conjugated with alkaline phosphatase (Roche Diagnostics) diluted 1 in 5,000 for 30 min at 37 °C ...
-
bioRxiv - Cell Biology 2021Quote: ... adapter-ligated libraries were prepared with the KAPA Hyper Prep Kit and sequencing libraries were constructed using SeqCap EZ Human Exome Library v3.0 (Roche, Basel, Switzerland). Cluster generation was performed with the HiSeq PE Cluster Kit v4 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... then incubated for 30 min in Ringer solution before plating on fibronectin-coated glass coverslips (human plasma fibronectin at 10 µg/ml, Roche 10838039001).
-
bioRxiv - Microbiology 2021Quote: ... falciparum 3D7 or HEK 293F cells were suspended in 1× pellet volume of lysis buffer supplemented with 20U of human placental RNase inhibitor and cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Resuspended parasites were then transferred to a prechilled nitrogen cavitation chamber (Parr Instrument Company ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human samples were analyzed using a combination of gene-specific primers and Universal Probe Library (UPL) hydrolysis probes (Roche Life Science). Threshold cycle (Ct ...
-
bioRxiv - Neuroscience 2020Quote: Total proteins from mouse cerebella or human cerebellar cortex were obtained by lysis in RIPA buffer containing protease inhibitors (Complete, Roche Diagnostics), followed by sonication and centrifugation using an established protocol in the laboratory31 ...
-
bioRxiv - Cancer Biology 2021Quote: ... paraffin-embedded human intestinal tissues was carried out on a Discovery Ultra automated slide stainer using a rabbit anti-human monoclonal antibody for CEA (Clone T84.66, Roche Glycart AG, Switzerland) at 2.23 µg/ml after antigen retrieval with Cell Conditioning 1 (CC1 ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Biophysics 2019Quote: ... or for confocal in a alkaline-washed glass-bottomed chamber coated with human plasma fibronectin (25 µg/mL at 4°C overnight in 1/3 X MBS; Roche Molecular Biochemicals) in DFA supplemented with antibiotic/antimycotic (Sigma) ...
-
bioRxiv - Cancer Biology 2023Quote: Cells were lysed using 10X Cell Lysis Buffer (Cell Signalling) supplemented with protease and phosphatase inhibitors (Roche). Protein concentration was determined using a BCA protein assay kit (Pierce ...
-
bioRxiv - Molecular Biology 2021Quote: ... cell viability was assessed using Cell Proliferation Kit I (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Cell growth was monitored using a CASY cell counter (Roche). PCR products or plasmids linearized by NotI were transfected into cells by electroporation (Biorad) ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell growth was monitored using a CASY cell counter (Roche). Expression of GFP fusion proteins and RNAi were induced with doxycycline at a final concentration of 10 ng/mL and 1 µg/mL ...
-
bioRxiv - Cell Biology 2024Quote: ... Cell growth was monitored using a CASY cell counter (Roche). PCR products or plasmids linearized by NotI were transfected into cells by electroporation (Biorad) ...
-
bioRxiv - Bioengineering 2022Quote: ... Slides were blocked in 10% BSA and 0.05% Tween 20 in PBS for 30 minutes before application of one of the following antibodies: mouse anti-human p16INK4a (CINTEC-Roche, cat# 705-4793), rabbit anti-human alpha-smooth muscle actin or aSMA (Abcam ...
-
bioRxiv - Cancer Biology 2022Quote: ... frozen human samples were disrupted in 600 µl of lysis buffer containing green ceramic beads using the MagNA Lyser Instrument (Roche Life Science, Germany). The cDNA synthesis was performed in a 20-µl reaction using random hexamers ...
-
bioRxiv - Microbiology 2022Quote: ... Quantification of beta-globin was performed by a commercially available human genomic DNA kit (The LightCycler Control Kit DNA, Roche Diagnostics, Basel, Switzerland)69.
-
bioRxiv - Systems Biology 2020Quote: ... Cell counting and assessment of cell viability were performed using the Cell Counter and Analyzer System (CASY, Roche).
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation in LNCaP IL1B overexpression and vector cells was assessed using Cell Proliferation Reagent WST-1 (Roche), per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: Cells proliferation was assessed by BrdU Cell proliferation ELISA from Roche. IL-6 ELISA was from Affimetrics ...
-
bioRxiv - Cancer Biology 2021Quote: Cell proliferation was evaluated using a colorimetric Cell Proliferation ELISA (Roche), based on the measurement of the incorporation of bromodeoxyuridine (BrdU ...
-
bioRxiv - Cancer Biology 2022Quote: ... Cell numbers were monitored using the CASY automated cell counter (Roche).
-
bioRxiv - Biochemistry 2023Quote: Cell proliferation was determined using a colorimetric Cell Proliferation ELISA (Roche) kit ...
-
bioRxiv - Immunology 2021Quote: Single-cells were sorted into PCR tubes containing 1μl of cell lysis solution (1:10 Cell Lysis buffer(Roche), 10U/μl Rnasin plus Ribonuclease inhibitor (Promega ...
-
bioRxiv - Cancer Biology 2020Quote: ... The cells were harvested by centrifugation and red blood cells were removed using a red blood cell lysis buffer (Roche). Samples for intracellular staining were stained with zombie red for 15 min at room temperature ...
-
bioRxiv - Cancer Biology 2022Quote: Viability and cell growth ratios were determined analyzing cell density by MTT using the Cell Proliferation Kit I (Roche, 11465007001) in DND41 cells treated with EX-527 (10-6 to 10-3 M ...
-
bioRxiv - Cancer Biology 2021Quote: ... Cells were then counted using a CASY cell counter (Roche, Basel, Switzerland). Final cell number was normalised to the initial cell count obtained at T0 ...
-
bioRxiv - Cancer Biology 2022Quote: ... the cell pellet was resuspended in red blood cell lysis buffer (Roche) and incubated at room temperature for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... Red blood cells were lysed using red blood cell lysis buffer (Roche), after which cells were again washed twice with cold AdDF+++ ...
-
bioRxiv - Biophysics 2020Quote: ... cell viability was determined using Cell Proliferation Reagent WST-1 (Roche, 5015944001) following the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: Cell proliferation was assessed by Cell Proliferation ELISA BrdU kit (11647229001, Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2020Quote: ... before cell numbers were determined using a CASY TT Cell Counter (Roche). 4×106 cells were transferred to 96-well plates for antibody staining ...
-
bioRxiv - Cancer Biology 2022Quote: ... B cells were thawed in B cell medium containing DNAse (Pulmozyme, Roche) 20 h before use in co-culture assays ...
-
bioRxiv - Bioengineering 2023Quote: ... cell viability was measured by the MTT assay (Cell proliferation kit, Roche Diagnostics Deutschland GmbH ...
-
bioRxiv - Cancer Biology 2024Quote: Cell viability was assessed using the MTT cell proliferation kit I (Roche), following the manufacturer’s instructions ...