Labshake search
Citations for Roche :
251 - 300 of 1362 citations for Real Time Thermal Cycler Thermocycler Accessories since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... on a LightCycler 480 thermocycler (Roche). PCR conditions were 95°C for 10 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... the real-time qPCR was performed on the Roche LightCycler96 (Roche, 05815916001) system ...
-
bioRxiv - Developmental Biology 2021Quote: ... Real-Time PCR was performed using FastStart SYBR Green Master (Roche Scientific) in a LightCycler 480 system II (Roche Scientific) ...
-
bioRxiv - Microbiology 2019Quote: ... Quantitative real time PCR was performed using a LightCycler 480 system (Roche) with the LightCycler 480 SybrGreen I Master mix ...
-
bioRxiv - Immunology 2020Quote: ... and amplification was monitored in real-time on a LightCycler 480 (Roche) to ensure the optimum number of cycles was used ...
-
bioRxiv - Microbiology 2022Quote: ... the semi-nested real-time q-PCR reactions (LightCycler 480 II, Roche Life Science ...
-
bioRxiv - Neuroscience 2021Quote: ... on a LightCycler 480 Instrument II Real-Time PCR Detection System (Roche). Primer sequences are provided in the Table 1 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time qPCR was undertaken using a LightCycler® 96 system (Roche). Relative expression levels were normalised to U6 (as this was stable in the small RNA sequencing data set ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCR amplifications were performed in a LightCycler480 system (Roche Diagnostics) in 384-well plates on 5 μL scale reactions using 2 μL diluted cDNAs and Brilliant III Ultra-fast SYBR Green qPCR Master Mix (Agilent ...
-
bioRxiv - Microbiology 2019Quote: Real-time quantitative PCR was done on a LightCycler 480 (Roche Diagnostics) using the SensiFast SYBR-NoRox kit (Bioline ...
-
bioRxiv - Genetics 2019Quote: ... Quantitative real-time PCRs were performed in the LightCycler 480 Instrument (Roche), using RealTime 2xPCRMaster Mix SYBR (A&A Biotechnology ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by the real-time PCR analysis using LightCycler96 (Roche Applied Science). Nucleotide sequences of the primers are shown in S1 Table.
-
bioRxiv - Plant Biology 2019Quote: ... Real-time quantitative PCR was performed in the LightCycler 480 system (Roche) using primers listed in Table S1 ...
-
bioRxiv - Neuroscience 2019Quote: ... and amplified via real-time PCR (4ng RNA/reaction; Lightcycler 480, Roche Diagnostics Corporation ...
-
bioRxiv - Neuroscience 2020Quote: ... Library titer was determined by real-time PCR (Kapa Biosystems, Wilmington, MA) on a Quant Studio 12K Flex Real Time PCR System (ThermoFisher ...
-
bioRxiv - Physiology 2021Quote: ... Sybr Green real-time RT-PCR assay probes (Roche Universal Probe library): Fw 5’gagcgtcgcagagaacttaga3’ and Re 5’ ttcctctggtaggcgattctt3’ (CALDESMON) ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR was performed using LightCycler® 480 System (Roche) with the SensiFAST Sybr No-Rox mix (Bioline ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR was performed using LightCycler® 480 System (Roche) with the SensiFAST Sybr No-Rox mix (Bioline ...
-
bioRxiv - Plant Biology 2021Quote: ... Quantitative real-time PCR was performed using LightCycler® 480 System (Roche) with the SensiFAST Sybr No-Rox mix (Bioline ...
-
bioRxiv - Physiology 2021Quote: ... Real-time PCR was carried out using an LightCycler® 480 (Roche) with Fast SYBR® Green Master Mix (Roche ...
-
bioRxiv - Microbiology 2021Quote: Real-time PCR was performed using the Roche LightCycler 96 Instrument (Roche Molecular Systems ...
-
bioRxiv - Neuroscience 2020Quote: ... Library titers were determined using real time PCR (Kapa Biosystems, Wilmington, MA) on a StepOnePlus Real Time System (ThermoFisher ...
-
bioRxiv - Neuroscience 2019Quote: ... Real-time PCR was performed by the LightCycler® System (Roche Diagnostics) following the manufacturer’s specifications ...
-
bioRxiv - Developmental Biology 2022Quote: ... Quantitative real-time PCR was performed using LightCycler® 480 II (Roche) and iTaq™ Universal SYBR® Green Supermix (Bio-Rad ...
-
bioRxiv - Microbiology 2022Quote: The experiment was performed using the High-Performance Real Time PCR (Roche) LightCycler® 480 Systems (Roche) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Quantitative real-time PCR was performed in a LightCycler 480 II (Roche) using the 5X HOT FIREPol EvaGreen q PCR Mix Plus (#08-24-00001 ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time PCR was undertaken using a LightCycler® 96 system (Roche). Steady-state transcript abundance of potential endogenous control genes was measured in the small RNA sequencing data ...
-
bioRxiv - Immunology 2019Quote: ... Real-time quantitative PCR was performed using SYBR Green I Master (Roche) with the following primers (Eurogentec) ...
-
bioRxiv - Genetics 2019Quote: ... Real time qPCR was performed on a LightCycler 480 (Roche, Indianapolis, IN). The expression of genes of interest was determined using the following TaqMan® Gene Expression Assays from Applied Biosystems (Foster City ...
-
bioRxiv - Biochemistry 2019Quote: ... Quantitative real-time PCR was performed using a LightCycler480 (Roche Molecular Diagnostics), in triplicates ...
-
bioRxiv - Pathology 2020Quote: ... were performed on the LightCycler® 480 Real-Time PCR System (Roche). The quantitative PCR profile consisted of an initial denaturation at 95°C for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... Real-time PCR was carried out using SYBR Green PCR mix (Roche) in Roche LightCycler 480II Instrument.
-
bioRxiv - Developmental Biology 2020Quote: ... Real Time PCR was performed with SYBR Green (Roche, Indianapolis, IN, USA) in a Light cycler 480 machine (Roche) ...
-
Satb2 acts as a gatekeeper for major developmental transitions during early vertebrate embryogenesisbioRxiv - Developmental Biology 2020Quote: Quantitative real time PCR was performed using SYBR green chemistry (KAPA biosystems) using gene specific primers as listed below on ViiA7 thermal cycler (Applied Biosystems) ...
-
bioRxiv - Immunology 2022Quote: ... Real-time quantitative PCR was performed using SYBR Green I Master (Roche) with the primers described in the Key resource table (Eurogentec).
-
bioRxiv - Cell Biology 2020Quote: ... in a LightCycler® 96 Real-Time PCR System (Roche Life Science). Primers ...
-
bioRxiv - Immunology 2021Quote: ... Samples were analyzed by real-time PCR with LightCycler Taqman Master (Roche) and Universal ProbeLibrary (UPL ...
-
bioRxiv - Plant Biology 2022Quote: ... Quantitative real-time PCR (qPCR) was carried out using LightCycler 480 (Roche) and the SYBR Green Master Mix (Bioline) ...
-
bioRxiv - Immunology 2022Quote: ... Quantitative real-time PCR (qRT-PCR) was performed with SYBR green (Roche) in a StepOnePlus system (Applied Biosystems) ...
-
bioRxiv - Physiology 2022Quote: ... Amplification was performed with the LightCycler 480 Real-Time PCR system (Roche) as previously described (8).
-
bioRxiv - Microbiology 2023Quote: We performed real-time PCR on a LightCycler 480 machine (Roche, Switzerland) using the LightCycler 480 SYBR I Master kit (Roche ...
-
bioRxiv - Developmental Biology 2023Quote: An xCELLigence Real-Time Cell Analyzer (RTCA, Acea Biosciences/Roche Applied Science) was used to assess barrier function of HUVEC monolayers ...
-
bioRxiv - Plant Biology 2023Quote: ... RT-qPCR was performed using LightCycler 480II Real Time system (Roche, USA) as per the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Real-time RT-PCR was performed with LightCycler® 480 II (Roche) using DyNAmo ColorFlash SYBR Green (Thermo Scientific) ...
-
bioRxiv - Cancer Biology 2023Quote: ... Quantitative real-time PCR was performed using SYBR Green DNA binding (Roche). Fifteen nanograms of RNA was converted to cDNA using specific primers for KLF2 (Forward ...
-
bioRxiv - Molecular Biology 2023Quote: ... Real-time qPCR was carried out using a LightCycler 480 instrument (Roche) and the LightCycler 480 SYBR green master mix (Roche) ...
-
bioRxiv - Systems Biology 2023Quote: ... Real-time PCR was conducted using the SYBR green PCR reagent (Roche) and StepOnePlus™ System (Applied Biosystems ...
-
bioRxiv - Evolutionary Biology 2023Quote: Real-time quantitative PCR was run using the LightCycler 480 system (Roche). All DNA samples were analyzed in triplicates for each quantification ...
-
bioRxiv - Molecular Biology 2023Quote: ... RT products were amplified by real time PCR (LightCycler™ 480, Roche) using SYBR Green I Master mix (Roche ...
-
bioRxiv - Immunology 2023Quote: ... Real-time qPCR was performed with Syber Green I Master kit (Roche) on a Light Cycler LC480 instrument (Roche) ...