Labshake search
Citations for Roche :
201 - 250 of 1362 citations for Real Time Thermal Cycler Thermocycler Accessories since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... and a LightCycler® 480 Real-time PCR System (Roche) according to the manufacturers’ protocols ...
-
bioRxiv - Developmental Biology 2023Quote: ... on a Real-Time PCR System (LightCycler® 480 (Roche) or CFX Connect (BIO-RAD)) ...
-
bioRxiv - Cell Biology 2024Quote: ... and a real-time PCR instrument LightCycler (Roche, Ltd., Germany) as previously reported 17 ...
-
bioRxiv - Plant Biology 2024Quote: ... and a Lightcycler 480 Real-Time PCR system (Roche Diagnostics), according to the supplier’s instructions ...
-
bioRxiv - Genetics 2024Quote: ... Real-time PCR was run in a Lightcycler 480 (Roche), using SYBR Green Master Mix–BioRad as a fluorescent dye ...
-
bioRxiv - Microbiology 2023Quote: ... where SARS-CoV-2 RNA was detected by real time reverse transcriptase real time polymerase chain reaction (RT-PCR) one either a Cobas® 6800 (Roche Diagnostics GmbH (Mannheim, Germany)) ...
-
bioRxiv - Cell Biology 2022Quote: ... and LightCycler480 Thermocycler (Roche, Switzerland). For RT-PCR studies ...
-
bioRxiv - Biochemistry 2023Quote: ... and LightCycler 480 thermocycler (Roche). Primers used for the PFK target and reference genes are listed in Table 2.
-
bioRxiv - Cancer Biology 2021Quote: ... Real-time PCR was performed in triplicates with LC FastStart DNA Master SYBR Green I on a LightCycler rapid thermal cycler system (Roche Diagnostics, Mannheim, Germany), according to the manufacturer’s instructions ...
-
CRISPR-SID: identifying EZH2 as a druggable target for desmoid tumors via in vivo dependency mappingbioRxiv - Cancer Biology 2021Quote: ... combined with a LightCycler® 480 Real-Time PCR System (Roche). Expression was normalized to housekeeping genes Actb ...
-
bioRxiv - Molecular Biology 2021Quote: ... and monitored in real-time with a LightCycler 480 instrument (Roche). The primers used are listed in (Table S3) ...
-
bioRxiv - Cell Biology 2019Quote: ... Real time quantitative PCR was performed using SYBR Green (Kapa Biosystems) or TAQMAN probes (details provided in supplementary table 1 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Real time PCR analysis was performed using SYBR green mix (Roche) and the values were normalized to β-actin values ...
-
bioRxiv - Cell Biology 2019Quote: ... in a LightCycler 480 Real-Time PCR System (Roche Applied Science) as follows ...
-
bioRxiv - Microbiology 2021Quote: ... and the LightCycler 480 Real-Time PCR System (Roche, Basel, Switzerland). RNA extraction was performed using the Roche High Pure Viral RNA Kit (Roche ...
-
bioRxiv - Bioengineering 2021Quote: ... Real-time qPCR was performed using LightCycler® 96 Instrument (Roche). RT-qPCR quantification of Hsp70Bb-Cas9 expression was done relative to RPL32 and ATPsynCF6 ...
-
bioRxiv - Microbiology 2021Quote: ... in a LightCycler 480 Real Time PCR system (Roche, Basel, Switzerland) for qRT-PCR analysis ...
-
bioRxiv - Cell Biology 2021Quote: ... Quantitative real-time PCR was performed using LightCycler96 (Roche Applied Science) with FastStart SYBR Green Master (Roche Applied Science) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Quantitative real-time PCRs were performed on a LightCycler 480 (Roche) with SYBR Green I (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... was used with a LightCycler 480 Real-Time PCR System (Roche) as previously described (38) ...
-
bioRxiv - Developmental Biology 2020Quote: ... The real-time PCR was performed on a Lightcycler 480 (Roche) using the SYBR Green I Master PCR kit with gene-specific primers ...
-
bioRxiv - Genomics 2022Quote: ... on a 384-well LightCycler 480 Real-Time PCR System (Roche) and threshold cycle (Ct ...
-
bioRxiv - Cancer Biology 2019Quote: ... Real-time PCR was performed using SYBR Green I (Roche, USA). Amplification was performed as follows ...
-
bioRxiv - Molecular Biology 2020Quote: ... Real-time quantitative PCR analysis was performed on a LightCycler480 (Roche) real-time PCR system using SybrGreen as well as TaqMan technologies ...
-
bioRxiv - Molecular Biology 2021Quote: ... Quantitative real-time PCRs were performed on a LightCycler 480 (Roche) with SYBR Green I (Roche ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: Real-time PCR was performed in a LightCycler 480 (Roche Diagnostics), using the LightCycler 480 SYBR Green I Master Kit (Roche Diagnostics ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... on the LightCycler 480 Real-Time PCR system (Roche, Rotkreuz, Switzerland). ORF 1ab was amplified from cDNA and cloned into MS2-nCoV-ORF1ab and used as the plasmid standard after its identity was confirmed by sequencing ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10 μL KAPA HiFi Real Time PCR master mix (KAPA Biosystems) and 9 μL size selected DNA solutions in a total reaction volume of 20 μL ...
-
bioRxiv - Cell Biology 2019Quote: ... Quantitative PCR was performed with the Applied BiosystemsTM PowerUP™ SYBR™ Green Master Mix from Applied Biosystems on a real-time PCR instrument (LightCycler® 480 System, Roche) using the primers listed in Supplementary Table 2.
-
bioRxiv - Genetics 2020Quote: ... SYBR Green based real-time qPCR (Sybr Green I Master, Roche) was performed on a LightCycler480 (Roche ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and run on a LightCycler 480 real-time PCR instrument (Roche). The quantified libraries were prepared for sequencing utilizing a TruSeq paired-end cluster kit (v3) ...
-
bioRxiv - Plant Biology 2021Quote: ... in a LightCycler 480 Real-Time PCR System (Roche, Basal, Switzerland). Expression levels were normalized by ACTIN2 (ACT2) ...
-
bioRxiv - Cell Biology 2021Quote: ... using LightCycler ® 96 Real-Time PCR System (Roche Life Science). The specificity of the primers was verified with a single peak in the melt curve ...
-
bioRxiv - Cell Biology 2020Quote: ... Real-time PCR was carried out on LightCycler®480 (Roche) using SYBR-green ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified using the KAPA real-time library amplification kit (Roche). Libraries were purified using PCRClean DX beads (Aline Biosciences ...
-
bioRxiv - Molecular Biology 2021Quote: Quantitative real time PCR was performed using SYBR green chemistry (Roche) with specific set of primer pairs (Supp Table 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The real time PCR was performed on a LightCycler480 system (Roche) using SYBR Green Master Mix (Roche ...
-
bioRxiv - Developmental Biology 2022Quote: ... Real-time PCR was performed by using Roche LightCycler96 (Roche, 05815916001) system and SYBR Green (Thermo Fisher Scientific ...
-
bioRxiv - Cell Biology 2022Quote: ... Quantitative real-time PCR was performed with SYBR Green I (Roche) using a CFX96 Touch Real-Time PCR Detection System (BIORAD) ...
-
bioRxiv - Genetics 2022Quote: ... on a LightCycler 480 Real-Time PCR System (Roche, Applied Science).2 µL (3 ng ...
-
bioRxiv - Microbiology 2023Quote: ... in combination with a LightCycler 480 real-time PCR system (Roche) and the RVS forward primers (AAAGGAACAATGGACTCTGGTCA) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and the LightCycler® 480 Real-Time PCR (Roche Life Science) system ...
-
bioRxiv - Genomics 2023Quote: ... on a 384-well LightCycler 480 Real-Time PCR System (Roche) and threshold cycle (Ct ...
-
bioRxiv - Molecular Biology 2023Quote: ... and performed using the LightCycler 480 Real-Time PCR Instrument (Roche). The amplification protocol was performed as follows ...
-
bioRxiv - Immunology 2023Quote: ... Real-time quantification was performed in triplicate with a LightCycler480 (Roche) using LightCycler 480 SYBR Green I Master (Roche ...
-
bioRxiv - Cell Biology 2023Quote: ... Real-time quantitative PCR was performed on a LightCycler 480 (Roche), and the relative fold change in gene expression was measured with the 2-ΔΔCT method.
-
bioRxiv - Genomics 2023Quote: ... in a LightCycler 96 Real-Time PCR System (Roche Applied Science). All reactions were performed in triplicates ...
-
bioRxiv - Microbiology 2024Quote: ... and run on a LightCycler 480 real-time PCR instrument (Roche). The quantified libraries were then multiplexed and the pool of libraries was then prepared for sequencing on the Illumina NovaSeq 6000 sequencing platform using NovaSeq XP v1 reagent kits (Illumina) ...
-
bioRxiv - Cell Biology 2021Quote: ... in a LightCycler 480 thermocycler (Roche) using LightCycler SYBR Green I master mix (Roche) ...
-
bioRxiv - Microbiology 2021Quote: ... in a LightCycler 480 thermocycler (Roche) according to the manufacturer’s protocol ...