Labshake search
Citations for Roche :
451 - 500 of 2419 citations for Primary Human Brain Microvascular Endothelial Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Genomics 2020Quote: ... This was followed with primary antibody incubation performed with 1:1000 goat anti-SOX17 (R&D) diluted with Antibody Dilution Buffer (Roche Ventana) for 60 minutes at 37°C ...
-
bioRxiv - Pathology 2019Quote: ... The slides were incubated in MRPL12 primary antibody (HPA022853, MilliporeSigma) at 1:200 dilution in Antibody Dilution Buffer (ADB250, Roche, Switzerland) for 45 min at RT ...
-
bioRxiv - Plant Biology 2019Quote: ... Blots were blocked for at least 1 hour in blocking solution at RT (5% milk in 1xTBS) before probing with primary antibody in blocking solution (α-HA-HRP, 1:2500 (Roche); α-PGB1 ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Microbiology 2022Quote: ... Immunoreactivity in the lung tissues was assessed using a rabbit anti-SARS-CoV-2 Nucleocapsid pAb as the primary antibody (Sinobiological, China) and further processed using a Ventana Discovery Ultra (Roche, USA) system.
-
bioRxiv - Pathology 2020Quote: ... Coverslips were incubated overnight at 4 °C with a 1:100 dilution with one of the following primary antibodies: HA (Roche, #867423001), KDEL (Abcam ...
-
bioRxiv - Genomics 2020Quote: ... Samples were hybridized with digoxygenin-labelled oligonucleotide probes directed to α-globin introns (30 ng per slide) and visualized using FITC-conjugated antibodies (primary: sheep anti-DIG FITC [Roche] 1:50 ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% bovine serum albumin (BSA)/TBS-T ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Plant Biology 2023Quote: ... Primary and secondary antibody dilutions used for immune detection were as follows: α-HA(rat)-1:2,000 (Roche Diagnostics, Basel, Switzerland), α-GFP(mouse)-1:1500 (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2023Quote: ... Embryos were gradually washed into SSC buffer and then into PBT before overnight incubation with an anti-DIG primary antibody at 1:5000 (Roche #11093274910). Embryos were washed in PBT and then staining buffer before developing in BM Purple staining solution (Roche #11442074001) ...
-
bioRxiv - Cell Biology 2023Quote: ... for 1 h at room temperature and incubated with primary antibodies overnight at 4°C against either HA (1:5000, Roche 12013819001), FLAG (1:1000 ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Biochemistry 2019Quote: ... and S278E amino acid substitutions were introduced into human RACK1 using the QuickChange II XL site-directed mutagenesis kit (Roche). All plasmids are available upon request.
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2022Quote: ... Between 50 and 100 ng of RNA was used as input for the KAPA RNA HyperPrep Kit with RiboErase (Human/Mouse/Rat) library preparation (Roche) on an automated liquid handling platform (Beckman Coulter) ...
-
bioRxiv - Immunology 2023Quote: K2 cells or human neutrophils were lysed with 150-200 µl of lysis buffer (supp. Table 2) supplemented with 1X complete inhibitor (Roche) and incubated for 10 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: Frozen brain tissues from human and animals were used to prepare 10% (w/v) homogenates in RIPA buffer containing PI and PhosStop (Roche). Briefly ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... The lysates were clarified by centrifugation and then incubated with primary antibodies or HA antibody conjugated beads (HA beads, Roche Applied Bioscience) overnight at 4°C ...
-
bioRxiv - Microbiology 2022Quote: ... all samples underwent primary PCR amplification (30 cycles) using the conventional V4 primers (515F-806R) and KAPA HiFi Hot Start DNA polymerase (KAPA Biosystems, USA), and secondary PCR was performed to add dual-indexes (IDT ...
-
bioRxiv - Genetics 2020Quote: ... Proteins were separated by SDS-PAGE on 4-12% Bis-TRIS SDS-polyacrylamide gels (Novex, NP0322BOX) and analysis was done against primary antibodies α-HA (1:1000, Roche, 12CA5) or α-Tub2 (1:4500 ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... The primary antibody was either visualized with the multimer-technology based UltraView Universal DAB Detection kit (Ventana® BenchMark® XT; Roche) or a fluorochrome-labeled secondary antibody (Alexa-conjugated ...
-
bioRxiv - Plant Biology 2023Quote: ... the membranes were incubated with primary antibody for 2.5 h (GFP, Abcam, Cambridge, UK: rabbit, 1:10000; HA [Roche], rat, 1:3000). Excess primary antibody was then removed by washing three times in 2x TBST (150 mM NaCl ...
-
Identification of plants functional counterparts of the metazoan Mediator of DNA Damage Checkpoint 1bioRxiv - Cell Biology 2023Quote: ... Samples were incubated with primary antibodies diluted 1:100 (rabbit pAb α-γH2A.X from SigmaAldrich, H5912 and mouse mAb α-GFP from Roche, 11814460001) in 1% BSA (in PBS ...
-
bioRxiv - Microbiology 2023Quote: ... Each membrane was incubated with rat anti-HA primary antibody (Sigma 11867423001; clone 3F10, monoclonal from Roche, 1:5000 in 5% milk) overnight at 4 °C ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... The primary antibody was either visualized with the multimer-technology based UltraView Universal DAB Detection kit (Ventana® BenchMark® XT; Roche) or a fluorochrome-labeled secondary antibody (Alexaconjugated ...
-
bioRxiv - Cell Biology 2020Quote: Whole cells were lysed in 1X Cell Lysis Buffer Cell (Cell Signalling) supplemented with cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). Protein concentration was determined by the Bradford assay using the Bradford reagent (Biorad ...
-
bioRxiv - Immunology 2021Quote: ... PBMC were seeded at 1 × 106 cells/mL in erythroid differentiation-promoting medium based on StemSpan™ Serum-Free Expansion Medium (SFEM) supplemented with human recombinant EPO (2 U/ml, Roche), human recombinant stem cell factor (25 ng/ml ...
-
bioRxiv - Immunology 2022Quote: ... The normalization of DNA amount was performed by quantifying albumin gene copies with qPCR using human genomic DNA (20 ng/µl) standard (Roche, #11691112001) as we previously described16.
-
bioRxiv - Microbiology 2019Quote: ... while all other specific primers were designed to be compatible with the Human Universal Probe Library set (90 probes, octamer, Roche Diagnostics) (Supplementary Table 9 ...
-
bioRxiv - Immunology 2019Quote: ... the wells were washed five times and incubated with 100 µl/well goat anti-human IgG conjugated with alkaline phosphatase (Roche Diagnostics) diluted 1 in 5,000 for 30 min at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were then cultured with 2 μg/ml of plate-bound anti-CD3 and anti-CD28 monoclonal antibodies (αCD3αCD28 stimulation) (mAbs) (eBioscience) and 25 U/ml of recombinant human interleukin-2 (IL-2; Roche Applied Science) at a concentration of 1.5-2 × 106 cells/ml in RPMI supplemented with 10% heat-inactivated Human Serum (HS ...
-
bioRxiv - Cell Biology 2021Quote: ... adapter-ligated libraries were prepared with the KAPA Hyper Prep Kit and sequencing libraries were constructed using SeqCap EZ Human Exome Library v3.0 (Roche, Basel, Switzerland). Cluster generation was performed with the HiSeq PE Cluster Kit v4 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... then incubated for 30 min in Ringer solution before plating on fibronectin-coated glass coverslips (human plasma fibronectin at 10 µg/ml, Roche 10838039001).
-
bioRxiv - Microbiology 2021Quote: ... falciparum 3D7 or HEK 293F cells were suspended in 1× pellet volume of lysis buffer supplemented with 20U of human placental RNase inhibitor and cOmplete™ EDTA-free Protease Inhibitor Cocktail (Roche). Resuspended parasites were then transferred to a prechilled nitrogen cavitation chamber (Parr Instrument Company ...
-
bioRxiv - Cancer Biology 2022Quote: ... Human samples were analyzed using a combination of gene-specific primers and Universal Probe Library (UPL) hydrolysis probes (Roche Life Science). Threshold cycle (Ct ...
-
bioRxiv - Neuroscience 2020Quote: Total proteins from mouse cerebella or human cerebellar cortex were obtained by lysis in RIPA buffer containing protease inhibitors (Complete, Roche Diagnostics), followed by sonication and centrifugation using an established protocol in the laboratory31 ...
-
bioRxiv - Neuroscience 2023Quote: ... prior to transfection with 2 μg pcDNA3.1 encoding N-terminally HA-tagged human 1N3R tau or 1N4R tau (14) using X-tremeGENE 9 (Roche Life Sciences), following the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Fixed and permeabilized embryos were incubated with DIG or Fluorescein-labeled RNA probes and the labeled probes were detected by Alkaline Phosphatase (AP)-conjugated primary antibodies (Roche Cat# 11093274910, RRID:AB_514497) and Roche Cat# 11426338910 ...
-
bioRxiv - Cell Biology 2022Quote: ... cells were incubated with the primary antibodies diluted in blocking solution (H3K9me3: ab8898, 1:500, HP1α: CST #2616, 1:200, HA: Roche 3F10, 1:250) for 1h at room temperature ...
-
bioRxiv - Neuroscience 2023Quote: ... Slices were then mounted to glass slides and coverslipped with Vectashield Vibrance (Vector H-1700) Primary antibodies used for immunohistochemistry (IHC) are listed here with dilutions indicated in parentheses: rat anti-HA (Roche 11867423001, 1:500), chicken anti-GFP (Abcam ab13970 1:1500) ...