Labshake search
Citations for Roche :
1 - 50 of 4984 citations for Nucleic Acid Purification kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acids were extracted using the High Pure Viral Nucleic Acid Kit (Roche) according to the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2023Quote: ... or High Pure Viral Nucleic Acid kit (Roche) kits ...
-
bioRxiv - Molecular Biology 2021Quote: ... RNA was isolated (nucleic acid purification on the MagNA Pure 96; Roche Life Science), reverse transcribed and Taqman PCR (on the 7500 RealTime PCR system ...
-
bioRxiv - Systems Biology 2023Quote: ... DNA was extracted and purified using the MagNA Pure nucleic acid purification platform (Roche Diagnostics Corp. ...
-
bioRxiv - Microbiology 2024Quote: ... RNA was isolated (nucleic acid purification on the MagNA Pure 96; Roche Life Science), reverse transcribed and Taqman PCR (on the 7500 RealTime PCR system ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from 253 resuspended vaginal swab samples using the MagNA Pure Compact Nucleic Acid Isolation Kit (Roche) [33] ...
-
bioRxiv - Microbiology 2019Quote: Viral nucleic acid was extracted from 200µl of the filtrate using the High Pure viral nucleic acid kit (Roche Diagnostics, USA) following the standard protocol ...
-
bioRxiv - Developmental Biology 2019Quote: ... and detected with the DIG Nucleic Acid Detection Kit (Roche). Wing imaginal discs were mounted in glycerol and imaged with a Nikon E200 bright-field microscope.
-
bioRxiv - Plant Biology 2020Quote: ... Digoxigenin was detected using DIG Nucleic Acid Detection Kit (Roche, USA).
-
bioRxiv - Genetics 2021Quote: ... with the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Total RNA was isolated via MPLC Total Nucleic Acid Isolation Kit (Roche) using automated MagNA Pure LC Instrument (Roche) ...
-
bioRxiv - Pathology 2020Quote: ... RNA was extracted with the High Pure Kit Nucleic Acid Kit DNA-RNA (Roche Diagnostics) according to the manufacturer’s recommendations ...
-
bioRxiv - Neuroscience 2021Quote: ... viral DNA was purified from SN (High Pure Viral Nucleic Acid Kit, Roche) and PCR was set up with Brilliant II qPCR Low ROX Master Mix (Agilent Technologies) ...
-
bioRxiv - Microbiology 2022Quote: Viral DNA was extracted by the High Pure Viral Nucleic Acid Kit (Roche) and eluted in 40 μM (μL ...
-
bioRxiv - Microbiology 2023Quote: ... 0.4% blocking reagent for nucleic acids (Roche, Switzerland)) ...
-
bioRxiv - Microbiology 2021Quote: RNA from virus was extracted using High Pure Viral Nucleic acid extraction kit (Roche). Using gene specific reverse primers of target genes ...
-
bioRxiv - Immunology 2021Quote: ... RNA was extracted from samples using Magnapure LC total nucleic acid isolation kit (Roche). RNA amplification and quantification were carried out using a 7500 Real-Time PCR System (Applied biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... or using a manual protocol with the High Pure Viral Nucleic Acid kit (Roche Molecular Systems Inc. ...
-
bioRxiv - Developmental Biology 2023Quote: ... for nucleic acid hybridization and detection (BBR, Roche, 11096176001) in MAB buffer at RT for 90 min ...
-
bioRxiv - Neuroscience 2023Quote: ... using SYBR green as nucleic acid stain (Roche 4913850001). To specifically quantify mRNA expression ...
-
bioRxiv - Microbiology 2021Quote: ... Viral DNA was extracted using the Roche high pure viral nucleic acid kit (Roche, USA) according to manufacturer’s instructions and circular DNA was enriched by rolling circle amplification (RCA ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and purified in large volume columns (High Pure Viral Nucleic Acid Large Volume Kit, Roche) using 2.5 ml of PB buffer ...
-
bioRxiv - Pathology 2023Quote: ... viral DNA was isolated using the High Pure Viral Nucleic Acid kit (Roche Applied Science). Viral titers in terms of viral genome per milliliter (vg/mL ...
-
bioRxiv - Genomics 2020Quote: ... concentrators and purified in large volume columns (High Pure Viral Nucleic Acid Large Volume Kit, Roche) using 10X (2.5 ml ...
-
bioRxiv - Microbiology 2019Quote: RNAs were re-extracted from the pig feces using High Pure Viral Nucleic Acid Kit (Roche), and cDNA was synthesized with random primers using SuperScript Ⅲ First-Strand Synthesis System (Invitrogen) ...
-
bioRxiv - Microbiology 2020Quote: ... or the MagNA Pure LC Total Nucleic Acid Isolation Kit (Cat. 03038505001, Roche Diagnostic, Basel, Switzerland) following the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2022Quote: ... Nucleic acid extraction was performed using the MagNA Pure Compact DNA Isolation Kit I (Roche Diagnostics) on the MagNA Pure LC automated extractor ...
-
bioRxiv - Immunology 2020Quote: ... viral RNA was isolated from plasma using a MagNA PureCompact Nucleic Acid Isolation kit (Roche Diagnostics). Real-time RT-PCR was performed using a QuantiTec Probe RT-PCR kit (Qiagen ...
-
bioRxiv - Microbiology 2022Quote: ... Viral DNA was then extracted using the High Pure Viral Nucleic Acid Kit (Roche Applied Science) following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2019Quote: ... Nucleic acids were removed with 250 U of Benzonase (Roche) for 1 hr at 4° C ...
-
bioRxiv - Microbiology 2022Quote: ... The absence of kit/reagent contamination was verified in the High Pure Viral Nucleic Acid Kit (Roche Applied Science) and Illustra™ GenomiPhi V2 DNA Amplification Kit (GE Healthcare Life Sciences ...
-
bioRxiv - Microbiology 2020Quote: ... GISAID: EPI_ISL_413570) obtained from cell culture using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche). We determined the slope by linear regression in GraphPad Prism and defined the required levels for PCR efficiency (E ...
-
bioRxiv - Molecular Biology 2022Quote: Total RNA was extracted using the column-based High Pure Viral Nucleic Acid Kit (Roche, Basel, Switzerland), according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2021Quote: ... 40% isopropanol) and DNA was purified using a High Pure Viral Nucleic Acid kit (Roche Life Science) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... 2015) that uses the tube assemblies from the High Pure Viral Nucleic Acid Large Volume kit (Roche, 05114403001). The intact ossicles were placed in the extraction buffer ...
-
bioRxiv - Plant Biology 2023Quote: ... Hybridization and probe detection was performed using a DIG Luminescent Detection Kit for Nucleic Acids (Roche Diagnostics, UK) as per the manufacturer’s protocol.
-
bioRxiv - Genomics 2024Quote: ... they were purified in large volume columns using the High Pure Viral Nucleic Acid Large Volume Kit (Roche) with 2.5 mL of PB buffer ...
-
bioRxiv - Microbiology 2020Quote: ... total nucleic acid was extracted from 400 µl of cerebrospinal fluid using the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics, Indianapolis, IN, USA) on the MagNA Pure compact automated extractor ...
-
bioRxiv - Neuroscience 2019Quote: ... Slides were then blocked with 0.5% nucleic acid blocking reagent (Roche 11096176001) dissolved in a 1x PBS containing maleic acid (Sigma M0375 ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from clinical isolates using the AMPLICOR® Respiratory Specimen Preparation Kit (Roche, Basel, Switzerland) and purified with 1.8X AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Microbiology 2022Quote: ... DNA extraction were carried out using MagNA Pure LC total Nucleic acid isolation kit on the automated MagNA Pure LC2.0 platform (Roche) from two to five colonies picked up from fresh cultured plates.
-
bioRxiv - Microbiology 2024Quote: ... Viral RNA isolation was performed using the MagNA Pure LC system (Total nucleic acid isolation kit, Roche Molecular System) or the EZ2 Connect system (EZ1&2 Virus Mini Kit v2.0 ...
-
bioRxiv - Microbiology 2021Quote: Total nucleic acid was extracted from a 200µL sample using the MagnaPure24 (Roche) External Lysis Pathogen 200 protocol with elution into 50 µL ...
-
bioRxiv - Genetics 2021Quote: ... For whole-genome sequencing DNA was extracted using the MagNA Pure LC Total Nucleic Acid Isolation Kit (Roche Diagnostics GmbH).
-
bioRxiv - Genomics 2019Quote: ... The supernatants from the digestion and initial decalcification step were purified using a 5 M guanidine-hydrochloride binding buffer with a High Pure Viral Nucleic Acid Large Volume kit (Roche). The extract was eluted in 100 μl of a 10mM tris-hydrochloride ...
-
bioRxiv - Microbiology 2021Quote: ... was extracted from inactivated samples (200 μL) using the MagNA Pure Compact instrument and MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Molecular Systems Inc ...
-
bioRxiv - Microbiology 2019Quote: ... Sendai Virus (SeV) and Modified vaccinia Ankara (MVA)-gfp viral stocks were extracted using the High Pure Viral Nucleic Acid Kit (Roche). When indicated ...
-
bioRxiv - Microbiology 2020Quote: ... whole specimens were processed into head/thorax homogenates for RNA extraction with the High Pure Viral Nucleic Acid Kit (Roche), according to manufacturer’s instructions (Moreira et al. ...
-
bioRxiv - Immunology 2020Quote: Genomic DNA was extracted from homogenized tissue of adenovirus vectored vaccine inoculated mice by High Pure Viral Nucleic Acid Kit (Roche). DNA fragments of Sad23L and Ad49L vectors were amplified by nested PCR with primers specific to adenoviral hexon sequences (Table S4 ...