Labshake search
Citations for Roche :
651 - 700 of 1612 citations for IL 5 Human HEK293 His since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biophysics 2024Quote: ... 5 μM LMD-009 and EDTA-free protease inhibitor cocktail tablets (Roche). Then the suspension was incubated at room temperature for 1.5 h after adding apyrase (25 mU/mL ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Neuroscience 2019Quote: ... barcoded and enriched using the NimbleGen SeqCap EZ Human Exome Library v2.0 enrichment kit (Roche NimbleGen, Madison, WI, USA). Purified and quantified library pool was subsequently sequenced on an Illumina HiSeq 2000 sequencing instrument (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... DIG-labeled RNA probes for human NORAD were synthesized by in vitro transcription using a DIG-labeling mix (Roche). Primers used for amplification of the DNA template for each probe are provided in Supplementary File 1 ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Neuroscience 2023Quote: ... and NexCreERT2::R26R-tdT male mice received intraperitoneal injections (i.p.) of recombinant human (rh)EPO (5000 IU/kg body weight; NeoRecormon, Roche) or PL (solvent solution ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5% glycerol and 140 mM NaCl) supplemented with Protease Inhibitor Cocktail (PIC, Roche) on ice for 10 min ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and 5-bromo4-chloro-3-indolyl phosphate toludinium (Roche Diagnostics, Cat. No 11383221001). Images were taken on a Zeiss Axio Compound Light Microscope with Optronics MacroFire Digital Camera.
-
bioRxiv - Developmental Biology 2020Quote: ... blocking was in 5% Horse Serum (X?) and 0.5% Western Blocking Reagent (Roche) MABTween solution and anti-DIG-POD was used ...
-
bioRxiv - Immunology 2019Quote: ... 5% glycerol) containing Complete® protease inhibitor and Phosphostop® phosphatase inhibitors (Roche). Immunoprecipitation was then conducted by first preclearing lysates with protein A/G-Sephrose (Thermo Fisher Scientific ...
-
bioRxiv - Pathology 2019Quote: ... 5 min each with 2x SSC (Roche-Apply science 11 666 681 001) by submerging in a tray on a rotating platform ...
-
bioRxiv - Genomics 2019Quote: ... 62°C for 5 min) using KAPA HiFi HotStart ready mix (KAPA Biosystems) and NextFlex primer mix (Bio Scientific ...
-
bioRxiv - Biochemistry 2019Quote: ... 5 mM mercaptoethanol) with a tablet of cOmplete™ Protease Inhibitor Cocktail (Roche). The suspension was sonicated (10 minutes ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5% glycerol and 140 mM NaCl) supplemented with Protease Inhibitor Cocktail (PIC, Roche) on ice for 10 min ...
-
bioRxiv - Neuroscience 2021Quote: ... 5 μM DTT) containing protease inhibitor (Complete Mini, EDTA-free; Roche Applied Science), 10 U/ml benzonase Nuclease (Sigma ...
-
bioRxiv - Cancer Biology 2020Quote: ... Reaction mix contained 5 μl of buffer I (Expand Long Template, Roche, Germany), 3% (v/v ...
-
bioRxiv - Cell Biology 2021Quote: ... and then stained with 5 μl Annexin V and 5μl PI (Roche, Germany) for 20 min and analyzed with Beckman CytoFLEX flow cytometry ...
-
bioRxiv - Physiology 2022Quote: ... 5 mM MgCl2 and 1 mM PMSF) supplemented with Protease Inhibitor Cocktail (Roche), 1 mM DTT ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 2 mM Dithiothreitol (DTT)) supplemented with protease inhibitor cocktail (Roche) and lysed by sonication on ice ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 10 mM imidazole supplemented with EDTA-free protease inhibitor (Roche). The cell suspension was lysed by ultrasonication and the lysate was cleared by centrifugation at 40,000 x g for 40 min ...
-
bioRxiv - Cell Biology 2022Quote: ... the 5-Bromo-2’-deoxy-uridine Labelling and Detection Kit II (Roche, UK) was used per manufacturer’s protocol ...
-
Noradrenergic alpha-2A receptor activation suppresses courtship vocalization in male Japanese quail.bioRxiv - Animal Behavior and Cognition 2021Quote: ... and 188 mg/mL 5-bromo-4-chloro-3-indolyl phosphate (Roche Diagnostics) in a solution of 0.1 M Tris (pH 9.5) ...
-
bioRxiv - Molecular Biology 2022Quote: ... The 5’ and 3’ linkers were terminally labelled with digoxigenin-11-dUTP (Roche) or biotin-16-dUTP (Roche) ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 5 μL of 5X Kapa Buffer (Kapa Biosystems, Inc., A Roche Company, Canada), 0.75 μL of 10 mM dNTPs ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... 5 μL of 5X Kapa Buffer (Kapa Biosystems, Inc., A Roche Company, Canada), 0.75 μL of 10 mM dNTPs ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 mM MgCl2 and 1 mM ATP with EDTA-free protease inhibitor (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... all membranes were blocked with 5% Western Blocking Reagent (Roche, Indianapolis, IN, USA) in TBST ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... the following were mixed: 5 μL Kapa HiFi buffer 5X (Kapa Biosystems, USA), 0.75 μL dNTPs 10 μM ...
-
bioRxiv - Immunology 2021Quote: ... and 5 mM Na3VO4) in the presence of complete Protease Inhibitor Cocktail (Roche). The cell lysates were incubated on ice for 30 min and were then centrifuged for 20 min at 15,000 rpm at 4°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercapto-ethanol) supplemented with 5 μg/ml DNase I (Roche) and lysed using a homogenizer (Avestin Emulsiflex C5 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5% glycerol and 10 mM imidazole supplemented with EDTA-free protease inhibitor (Roche). The cell suspension was lysed by ultrasonication and the lysate was cleared by centrifugation at 40,000 x g for 40 min ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche, Mannheim, Germany Cat#11383221001) was used in conjunction with nitro blue tetrazolium (NBT ...
-
bioRxiv - Microbiology 2021Quote: ... based on the 5′ and 3′ RACE kit (2nd generation, Roche, Basel, Switzerland). Viral nucleic acids were extracted from 140 μl of the virus transport medium derived from the nasopharyngeal swab using the viral RNA isolation kit according to the manufacturer’s protocol (Qiagen ...
-
bioRxiv - Immunology 2020Quote: ... Cytokines were added at the following concentrations: GM-CSF (5 ng/mL, Roche), TNF (10 ng/mL ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5) Incubated with 50μL of TUNEL reaction mixture for one hour (Roche protocol); 6 ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 5% glycerol) containing a protease inhibitor cocktail (Roche,11 697 498 001). The cell lysates were further sonicated on ice for 10 seconds ...
-
bioRxiv - Microbiology 2022Quote: ... and blocked at room temperature with either 5% bovine serum albumin (BSA, Roche), 5% milk or Odyssey buffer (1:1 ...
-
bioRxiv - Cell Biology 2022Quote: ... and 5% glycerol) containing 1× complete EDTA-free protease inhibitor cocktail (Roche 1187358001) and lysed in an Emulsiflex-C5 cell disruptor (Avestin) ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... determined as the amount of 5-bromo-2′-deoxy-uridine (BrdU) incorporation (Roche BrDU Labeling and Detection Kit II ...
-
bioRxiv - Genetics 2023Quote: ... 5 mM Tris-HCl (pH 7.4) supplemented with Protease Inhibitor cocktail (Roche, #04693159001) and transferred to a 7 mL Dounce tissue grinder (KIMBLE KONTES ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... After 3 minutes 10 μL of 5 mg/mL Liberase (Roche, cat # 05401119001) were added ...
-
bioRxiv - Developmental Biology 2023Quote: ... using a 5 μl reaction mixture of DNA SYBR Green I Master (Roche) according to the standard manufacturer’s protocol ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 35 mg/ml 5-bromo-4-chloro-3-indolyl-phosphate (BCIP, Roche). The reaction was stopped with PBS and the sections were mounted in Glycergel (Dako) ...
-
bioRxiv - Microbiology 2023Quote: ... 5 mM beta-mercaptoethanol (BME)) with cOmplete EDTA-free Protease Inhibitor Cocktail (Roche). After lysate centrifugation at 48.384g for 45 min at 4°C ...
-
bioRxiv - Microbiology 2023Quote: ... 5% glycerol) supplemented with Complete Mini protease inhibitor mixture tablet (Roche Applied Science) and 10 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The cell proliferation ELISA BrdU (5′-bromo-2′-deoxyuridine) colorimetric assay (Roche,11647229001) was performed as per the manufacturer’s instructions ...