Labshake search
Citations for Roche :
151 - 200 of 356 citations for Cytomegalovirus Purified Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... DNA was purified using a High Pure PCR Template Preparation Kit (Roche, 11796828001) and q-PCR was performed as describe above ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified using the High Pure Purification Kit (Roche Applied Science). The oligonucleotides used to amplify and sequence the different hit-related genes are listed in Table S4.
-
bioRxiv - Cell Biology 2023Quote: ... and ethanol precipitation and was further purified with KAPA Pure beads (KAPA Biosystems).
-
bioRxiv - Cell Biology 2023Quote: ... PCR products were purified using the High Pure PCR Product Purification Kit (Roche) and quantified using the Quant-iT™ PicoGreen™ dsDNA Assay Kit (ThermoFisher Scientific ...
-
bioRxiv - Molecular Biology 2021Quote: ... The PCR product was purified with 1.5x ratio KAPA pure bead (Roche Cat# KK8002) and then eluted into water ...
-
bioRxiv - Molecular Biology 2021Quote: ... The purified DNA fragments were prepared with the KAPA HTP Library Preparation kit (Roche) and single-end sequenced with a 65-cycle kit on an Illumina HiSeq 2500.
-
bioRxiv - Molecular Biology 2021Quote: ... QHR-4C libraries were purified by the High-Pure PCR Product Purification kit (Roche).
-
bioRxiv - Genomics 2020Quote: ... Final PCR products were purified with the High Pure PCR Product Purification Kit (Roche) and AMPure XP PCR purification kit (Agencourt AMPure XP).
-
bioRxiv - Biochemistry 2020Quote: ... MR-Fc was purified from cell culture supernatant using Protein A-agarose beads (Roche). For ELISA experiments ...
-
bioRxiv - Cell Biology 2021Quote: ... Purified libraries were normalized by qPCR using the KAPA Library Quantification Kit (KAPA Biosystems) and diluted to a final concentration of 10 nM ...
-
bioRxiv - Microbiology 2022Quote: ... All PCR products were purified by the High Pure PCR Product Purification Kit (Roche) before being used for TAR cloning.
-
bioRxiv - Neuroscience 2020Quote: ... Purified myelin was taken up in 1⨯ TBS with protease inhibitor (Complete Mini, Roche). For lysate analysis half brains of three Ctrl and iKO mice each at 8 ...
-
bioRxiv - Molecular Biology 2019Quote: ... The ligated samples were purified using the High-Pure PCR Product Purification kit (Roche). The 4C-seq libraries were generated by PCR using a high-fidelity DNA polymerase (Vazyme) ...
-
bioRxiv - Genetics 2019Quote: ... We purified the DNA with High-pure PCR Product Purification Kit (Roche, Cat#11732676001) and performed the 2nd round of PCR to attach to the libraries adaptor and index sequences for the NGS analysis for 8 cycles again with Tks Gflex™ DNA Polymerase (Takara ...
-
bioRxiv - Genetics 2019Quote: ... The DNA was purified with High-pure PCR Product Purification Kit (Roche, Cat#11732676001). The final libraries were pooled and sequenced with the HiSeq2500 system as described above ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Enriched libraries were purified using a 1X ratio of KAPA Pure beads (Roche, Switzerland) followed by quantification with the KAPA library quantification kit (Roche ...
-
bioRxiv - Biochemistry 2020Quote: ... released DNA was purified from protein components (High pure PCR Product Purification Kit, Roche) and chromatin quality analysed using EtBr agarose gel electrophoresis (1.3 % Biozym ME Agarose ...
-
bioRxiv - Biochemistry 2020Quote: ... released DNA was purified from protein components (High pure PCR Product Purification Kit, Roche) and analysed using ethidium bromide (EtBr ...
-
bioRxiv - Developmental Biology 2019Quote: ... purified and used for in vitro transcription reaction using Dig-RNA labeling kits (Roche). Following in situ hybridization ...
-
bioRxiv - Microbiology 2021Quote: ... Fab was purified from cell culture supernatant by cOmplete His-Tag Purification Resin (Roche).
-
bioRxiv - Microbiology 2022Quote: ... All PCR products were purified with the High Pure PCR Product Purification Kit (Roche) before being used for TAR cloning.
-
bioRxiv - Cancer Biology 2022Quote: ... The purified DNA fragments were prepared using the KAPA HTP Library Preparation Kit (Roche) following manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... All PCR products were purified by the High Pure PCR Product Purification Kit (Roche) before TAR cloning.
-
bioRxiv - Microbiology 2022Quote: ... The PCR product was purified with a PCR clean-up kit (Roche Applied Science) and end-labelled with T4 polynucleotide kinase (New England Biolabs) ...
-
bioRxiv - Microbiology 2022Quote: ... The probes were then purified using a PCR clean up kit (Roche Applied Science). The oligonucleotides had been ordered with 5’ biotinylated ends allowing for subsequent complex detection ...
-
bioRxiv - Microbiology 2022Quote: ... Virus RNA was purified using the High Pure Viral RNA kit (Roche, Basel, Switzerland), amplified using universal eight-segment primers and directly sequenced ...
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR products were purified with the High-Pure PCR Product Purification kit (Roche) and the library was sequenced by Illumina X ten platform.
-
bioRxiv - Molecular Biology 2023Quote: ... The PCR products were purified with the High-Pure PCR Product Purification kit (Roche) and then sequenced by the X ten platform.
-
bioRxiv - Genetics 2023Quote: ... We purified libraries to remove primer dimers and eliminate fragments over 1000bp (Roche 07983298001). We validated ATAC-seq library quality before sequencing for a subset of samples by observing appropriate nucleosomal banding patterns via capillary gel electrophoresis on an Agilent 4150 TapeStation system (Agilent 5067-5584) ...
-
bioRxiv - Systems Biology 2023Quote: ... DNA was extracted and purified using the MagNA Pure nucleic acid purification platform (Roche Diagnostics Corp. ...
-
bioRxiv - Neuroscience 2023Quote: ... His6-GFP and His6-mCherry proteins were purified with cOmplete His tag resin (Roche) according to the manufacturers protocols as previously described9 ...
-
bioRxiv - Microbiology 2023Quote: ... Amplified fragments with adapters and tags were purified using KAPA Pure beads (Roche, Switzerland) at a 1:1 concentration.
-
bioRxiv - Neuroscience 2023Quote: ... The resulting sgRNA was purified using the High Pure PCR Cleanup Microkit (Roche, 498395500). 60 pg sgRNA and 100 pg Cas9 protein (PNA Bio ...
-
bioRxiv - Cell Biology 2023Quote: ... Purified parasites were lysed in 1% SDS in PBS containing protease inhibitors (cOmplete, Roche) on ice for 30 minutes ...
-
bioRxiv - Immunology 2023Quote: ... were purified from any remaining oligos by a combination of beads (KAPA HyperPure, Roche) and enzymatic treatment with Thermolabile Exonuclease I (New England Biolabs) ...
-
bioRxiv - Immunology 2023Quote: ... Secreted IgGs were purified from cell supernatants with Protein A resin (Roche, Basel, Switzerland). IgGs were eluted at low pH using Protein A elution buffer (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR products were purified using the High Pure PCR product Purification Kit (Roche, Denmark). Subsequently the purified PCR products were sent for sequencing at LGC Genomics (Berlin ...
-
bioRxiv - Genetics 2019Quote: ... Purified DNA was analysed by quantitative PCR using Roche Lightcycler480 using SYBR green reagents (Roche). The following primers were designed to assess luciferase plasmid concentrations to normalise transfection efficiencies (LucChIP for;CTTGCAGTTCTTCATGCCCG ...
-
bioRxiv - Developmental Biology 2019Quote: ... Newly synthesized probes were purified using mini QuickSpin columns according to the manufacturer’s protocol (Roche). Synthesis of RNA probes was performed as described (North et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... the library fragments were purified with KAPA Pure Beads system (KAPA Biosystems, Roche, Basel, Switzerland). The library carrying appropriate adapter sequences at both ends was amplified using KAPA HiFi HotStart ReadyMix (KAPA Biosystems ...
-
bioRxiv - Cancer Biology 2022Quote: ... the library fragments were purified with KAPA Pure Beads system (KAPA Biosystems, Roche, Basel, Switzerland). The library carrying appropriate adapter sequences at both ends was amplified using KAPA HiFi HotStart ReadyMix (KAPA Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... Then concentrated supernatant was purified by immobilized metal-affinity chromatography with Ni-NTA resin (Roche) stocked in WET FRED gravity flow columns (IBA ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR product was purified using the High Pure PCR Product Purification Kit (Roche, Germany) and subjected to electrophoresis in 1% (w/v ...
-
bioRxiv - Microbiology 2020Quote: ... The PCR amplicon was purified using the High Pure PCR Product Purification Kit (Roche, Germany) to remove the contaminants and the amplicon was sequenced with forward and reverse primers using Big Dye Terminator v3.1 Cycle Sequencing kit on Applied Biosystems 3730 x l Genetic Analyzer ...
-
bioRxiv - Neuroscience 2021Quote: Purified immunopanned OPCs were rinsed with chilled PBS containing 1x PhosSTOP (Sigma-Aldrich-Roche, 4906845001) and 1x halt protease inhibitor cocktail (ThermoFisher ...
-
bioRxiv - Biochemistry 2019Quote: ... Clear lysate was affinity-purified by incubating it with cOmplete His-Tag purification resin (Roche) for 2 hours (4°C) ...
-
bioRxiv - Neuroscience 2020Quote: Genomic DNA was purified from buccal cells using a MagNA Pure96 robot (Roche Diagnostics, Mannheim), sample probes were designed by TIB MolBiol (Berlin ...
-
bioRxiv - Developmental Biology 2021Quote: ... His-tagged proteins in soluble fraction were purified using cOmplete His-Tag Purification Columns (Roche). The columns were washed with 10 column volumes of wash buffer 1 (20 mM Tris ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and purified in large volume columns (High Pure Viral Nucleic Acid Large Volume Kit, Roche) using 2.5 ml of PB buffer ...
-
Targeting properdin - Structure and function of a novel family of tick-derived complement inhibitorsbioRxiv - Immunology 2021Quote: ... Expressed proteins were subsequently purified using a cOmplete His-Tag Purification column (1mL column, Roche) and SEC (S200 ...