Labshake search
Citations for Roche :
101 - 150 of 356 citations for Cytomegalovirus Purified Antigen since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Purified libraries were quantified using the Kapa Library Quantification Kit (Roche), pooled in equimolar concentrations ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... We purified amplicons using Kapa Pure magnetic beads (Roche; Basel, Switzerland) and quantified them using the Picogreen dsDNA quantitation kit (Invitrogen ...
-
bioRxiv - Microbiology 2024Quote: ... and purified with the High Pure PCR product purification kit (Roche). Sequencing indexes were added by LGC ...
-
bioRxiv - Molecular Biology 2024Quote: ... the purified DNA was mixed with SYBR Green master mix (Roche) and specific primers ...
-
bioRxiv - Microbiology 2024Quote: ... The final amplicons were purified using KAPA HyperPure Beads (Roche, Switzerland) according to the manufacturer’s protocol.
-
bioRxiv - Immunology 2023Quote: ... and 0.25 mg/ml of Liberase TL purified enzyme blend (Roche) for 90 minutes at 37°C and 5% CO2 ...
-
bioRxiv - Plant Biology 2023Quote: ... Dissociated RNAs were purified using mini Quick Spin RNA Columns (Roche), then ethanol-precipitated ...
-
bioRxiv - Cancer Biology 2021Quote: ... Purified RNA was reverse transcribed to cDNA using Transcriptor Reverse Transcriptase (Roche), and the cDNA products subjected to PCR using 1 μl cDNA ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using 0.6X-1.2X KAPA Pure Beads (Roche, KK8000) and then further amplified using P5_seq_eGFP_F2 and P7_Ind_#_Han primers for 7 PCR cycles to add P5 ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were purified with High Pure PCR Product Purification Kit (Roche). After sequencing reaction ...
-
bioRxiv - Molecular Biology 2020Quote: ... Soluble protein was purified using batch/gravity-flow affinity chromatography (cOmplete, Roche). MED1 (50-660 ...
-
bioRxiv - Molecular Biology 2021Quote: ... DNA was purified from this aliquot using KAPA Pure beads (Roche, KK8000), resuspended in 10 mM Tris pH 8 and quantified using the Qubit dsDNA HS Assay kit (Thermofisher ...
-
bioRxiv - Neuroscience 2020Quote: ... and the RNA was purified using a Mini Quick Spin Column (Roche). 100 pg RNA was injected into the embryo at the one-cell stage.
-
bioRxiv - Microbiology 2021Quote: ... Amplicons were purified using the High Pure PCR Product Purification Kit (Roche) and afterwards restricted with BamHI (ThermoScientific ...
-
bioRxiv - Zoology 2021Quote: ... Amplicon products from indexing PCR were purified using KAPA Pure Beads (Roche) and their quality check was performed using Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2020Quote: ... Probes were purified using Quick Spin Columns for Radiolabelled DNA Purification (Roche). Nuclear extracts were harvested from COS-7 cells and samples were loaded on a 6% native polyacrylamide gel in TBE buffer (45 mM Tris ...
-
bioRxiv - Developmental Biology 2022Quote: ... All plasmids were purified with a Genopure Maxi kit (Roche, Basel, Switzerland) and the final concentration was 2 µg/µl.
-
bioRxiv - Immunology 2022Quote: ... The purified libraries were quantified with Kapa Library Quant Kit (KAPA Biosystems) and quality assessed on 4200 TapeStation System (Agilent) ...
-
bioRxiv - Microbiology 2021Quote: ... and purified by High Pure PCR Product Purification Kit (Roche, Mannheim, Germany) according to manufacturer’s instructions ...
-
bioRxiv - Pathology 2019Quote: ... The cDNA was purified by KAPA Pure Beads (Kapa Biosystems, Wilmington, MA) or with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2020Quote: ... His-tagged CopS(34-151) was purified using Ni-NTA columns (Roche)(11) ...
-
bioRxiv - Microbiology 2021Quote: ... Amplicons were purified using the High Pure PCR Product Purification Kit (Roche) and afterwards restricted with EcoRI (New England Biolabs ...
-
bioRxiv - Molecular Biology 2019Quote: ... de-crosslinked and purified using High Pure PCR Cleanup Micro Kit (Roche). The libraries were prepared using TruSeq ChIP Sample Preparation Kit (Illumina ...
-
bioRxiv - Molecular Biology 2019Quote: ... The DNA was purified using High Pure PCR Cleanup Micro Kit (Roche). DNA libraries were prepared using TruSeq ChIP Sample Preparation Kit (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... and 0.2 mg/ml Liberase CI purified enzyme blend (Roche Diagnostics Corp.), and incubated for 1-2 h at 37°C ...
-
bioRxiv - Cancer Biology 2023Quote: ... The purified cDNA was pre-amplified with KAPA HiFi HotStart ReadyMix (Roche) and MAC-seq PreAmp PCR primer and the quality checked on a D5000 Screentape (TapeStation ...
-
bioRxiv - Microbiology 2023Quote: ... the libraries were purified using a 0.8X KAPA Pure Bead (Roche, Switzerland) cleanup to remove unincorporated adapters ...
-
bioRxiv - Immunology 2023Quote: ... and ligated to gel-purified plasmid backbones using T4 DNA ligase (Roche). Competent DH5a E ...
-
bioRxiv - Molecular Biology 2023Quote: ... Damino was then purified with a mini-Quick Spin DNA Columns (Roche) to remove unincorporated ATP-γ-32P ...
-
bioRxiv - Immunology 2024Quote: ... The purified libraries were quantified with Kapa Library Quant Kit (KAPA Biosystems) and quality assessed on a 4200 TapeStation System (Agilent) ...
-
bioRxiv - Cell Biology 2020Quote: ... The PCR product was purified from gel cut with ClaI (cat#10656291001, Roche) and BamHI-HF (cat# R3136s ...
-
bioRxiv - Genetics 2021Quote: ... PCR products were purified using a High Pure PCR Product Purification Kit (Roche). Customized oligonucleotide primers (S1 Table ...
-
bioRxiv - Molecular Biology 2021Quote: ... PCR products were purified using the High Pure PCR product purification kit (Roche). Libraries were quantified with Qubit high sensitivity assays ...
-
bioRxiv - Molecular Biology 2022Quote: ... The reactions were purified with the High Pure PCR product purification kit (Roche) and digested with SacI and XbaI enzymes in M buffer (TaKaRa) ...
-
bioRxiv - Molecular Biology 2019Quote: PCR products were purified using a High Pure PCR Product Purification Kit (Roche) and sequenced by the Sanger method using forward and reverse PCR primers.
-
bioRxiv - Biochemistry 2019Quote: Some samples were further affinity purified using an HPC4 antibody-conjugated resin (Roche), but yields from the HPC4 column were low ...
-
bioRxiv - Systems Biology 2021Quote: Recombinant proteins were purified using the Anti-Protein C Affinity Matrix (11815024001, Roche) on an ASPEC liquid handling instrument (Gilson) ...
-
bioRxiv - Neuroscience 2021Quote: ... viral DNA was purified from SN (High Pure Viral Nucleic Acid Kit, Roche) and PCR was set up with Brilliant II qPCR Low ROX Master Mix (Agilent Technologies) ...
-
bioRxiv - Cancer Biology 2020Quote: PCR products were purified using a High Pure PCR Product Purification Kit (Roche) and sequenced by the Sanger method using forward and reverse PCR primers.
-
bioRxiv - Microbiology 2021Quote: ... The resulting amplicons were purified using High Pure PCR product purification kit (Roche) and shipped to Macrogen Europe B.V ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... The riboprobe was purified with EtOH precipitation and mini Quick Spin Columns (Roche) then stored at −80°C.
-
bioRxiv - Microbiology 2022Quote: ... DNA-free RNA was purified using a High Pure RNA isolation kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: Total RNA was isolated and purified using High Pure RNA Isolation Kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were purified using the High Pure PCR Product Purification Kit (Roche) following manufacturer’s guidelines ...
-
bioRxiv - Molecular Biology 2019Quote: ... and purified using a high pure PCR product purification kit (Roche, No. 11732668001). The DNA blots were prehybridized at 42°C for 1 h in DIG easy hyb granule and then hybridized to denatured DIG-labeled probes for 20 h ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified cDNA was subjected to PCR amplification using KAPA Library Amplification Kits (Roche) with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’ ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... libraries were purified with 110 μL (1X) of KAPA Pure Beads (Roche, 07983271001) and Short Fragment Buffer (Oxford Nanopore Technologies ...
-
bioRxiv - Synthetic Biology 2023Quote: ... and ligated to gel-purified plasmid backbones using T4 DNA ligase (Roche; 10799009001). New England Biolabs high efficiency competent 5α E ...
-
bioRxiv - Microbiology 2023Quote: ... and PCR products were purified using the DNeasy blood and tissue kit (Roche), the High Pure Plasmid Isolation kit (Roche) ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... barcoded amplicons were purified with 33 μL (1.2X) of KAPA Pure Beads (Roche) by following the official protocol and eluted with 11 μL of nuclease-free water (Thermo Scientific ...