Labshake search
Citations for Roche :
451 - 500 of 3928 citations for 8 4 Chlorophenylthio 2' O methyladenosine 3' 5' cyclic monophosphate sodium salt since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... Cells were lysed in High Salt RIPA buffer with protease (cOmplete EDTA-Free, Roche), phosphatase inhibitors (PhosSTOP ...
-
bioRxiv - Biochemistry 2023Quote: ... The cells were then thawed and resuspended in 1 ml lysis buffer (50 mM Tris pH 8, 150 mM NaCl, 0.5 mg/ml lysozyme, 2 mM EDTA and one Roche protease inhibitor tablet per 10 ml). Complete lysis was achieved after a 15-min incubation at room temperature ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 10 mM Tris-HCl pH 7.5/140 mM NaCl/1% NP-40/1% sodium deoxycholate/0.1% sodium dodecyl sulfate (SDS)) and 150 μL of Complete Mini protease inhibitor cocktail (Roche Diagnostic Systems, Laval, Canada). Harvested cells were sonicated using three 12-second bursts of a Sonic Dismembrator (model 500 ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Biophysics 2019Quote: ... or for confocal in a alkaline-washed glass-bottomed chamber coated with human plasma fibronectin (25 µg/mL at 4°C overnight in 1/3 X MBS; Roche Molecular Biochemicals) in DFA supplemented with antibiotic/antimycotic (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Molecular Biology 2021Quote: ... the supernatant was incubated for o/n with 40μl of anti-HA agarose beads (rat anti-HA, 3F10 Roche) at 4 °C ...
-
bioRxiv - Microbiology 2019Quote: ... Plates were washed again and then incubated with substrate solution (o-phenylendiamine, Nacalai Tesque, Kyoto, Japan or ABTS, Roche) for 20 min at 37 °C ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μL / well of MTT (3- [4,5-dimethylthiazol-2-yl] −0,5-diphenyl tetrazolium bromide (11465007001; Roche Life Science, Mannheim, Germany) labeling reagent (1× ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Molecular Biology 2019Quote: ... and viability was measured using the Roche MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) kit (Roche, Cat # 11465007001) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: Metabolic activity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-assay (Cell Proliferation Kit I, Roche Germany, Mannheim) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... the slides were washed in TBS/T 3 times and then incubated with secondary antibodies (2 µg/ml) and DAPI (1 µg/ml, Roche) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... The beads were then collected at 1000 g for 2 min and washed at least 3 times with lysis buffer coupled with protease inhibitor cocktail (Roche). After last wash and centrifugation ...
-
bioRxiv - Molecular Biology 2023Quote: ... uteri were harvested from pregnant mice at 4.5 days post coitus and washed with cold swelling buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 1X Protease Inhibitor Cocktail (PIC, Roche, 11836170001)) immediately after collection ...
-
bioRxiv - Molecular Biology 2020Quote: ... and then deproteinized by adding of 8 µl of 10% SDS and 8 µl of proteinase K (19 mg/ml stock, Roche). Deproteinization was carried out at 37 °C for 30 min with gentle flicking ...
-
bioRxiv - Molecular Biology 2019Quote: ... ~2 x 108 parasites were resuspended in 2 mL cytoplasmic lysis buffer (10 mM HEPES [pH 8], 10 mM KCl, 0.1 mM EDTA [pH 8], plus complete protease inhibitor [PI, Roche # 11836170001]), transferred to a prechilled 2 mL douncer homogenizer and set on ice for 30 min ...
-
bioRxiv - Microbiology 2022Quote: ... Beads were then washed three times with 400 μL wash buffer (25 mM Tris-HCl pH 8, 150 mM NaCl, 1 mM EDTA pH 8, cOmplete protease inhibitor cocktail (Roche), 5% glycerol) ...
-
bioRxiv - Molecular Biology 2023Quote: ... grown for 24 hours and transfected with 8 μg of plasmids and 8 μl of X-tremeGENE HP DNA Transfection Reagent (Roche). The cells were grown for 48 hours post-transfection and collected for downstream analyses.
-
bioRxiv - Neuroscience 2021Quote: ... This was spun down (5 minutes at 1800 RMP, 4°C) and the pellet then digested in 10ml collagenase/dispase (1mg/ml; Roche) and DNase I type IV (40µg/ml ...
-
bioRxiv - Neuroscience 2023Quote: ... The larvae were then incubated overnight at 4°C with anti-Dig-AP (1:2000 in 5% normal goat serum, 11093274910, Roche) and washed before detecting alkaline phosphatase using NBP/BCIP(Roche ...
-
bioRxiv - Biochemistry 2021Quote: ... 8 M urea and protease inhibitor (Roche, 05892791001) with sonication on ice ...
-
bioRxiv - Immunology 2019Quote: ... diluted 1:150 in washing buffer (45 min) and 4’,6-diamidino-2-phenylindole counterstain (DAPI; Roche/Sigma-Aldrich) diluted 1:250 in TBS (15 min ...
-
Neurotransmission and neuromodulation systems in the learning and memory network of Octopus vulgarisbioRxiv - Neuroscience 2021Quote: ... Fluorescent counterstaining of cell nuclei was carried out in a PBS solution with 0.1 µg/ml 4’,6-diamidino-2-phenylindole (DAPI; Roche Molecular Biochemicals ...
-
bioRxiv - Physiology 2020Quote: Islets were isolated from male C57BL/6 mice at 2 to 4 month of age using Collagenase P (Roche Diagnostics ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% NP40, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 0.1mM Na3VO4, 4 μg/ml leupeptin, one Roche cOmplete™ protease inhibitor tablet ...
-
bioRxiv - Molecular Biology 2023Quote: SDGC-SEC-purified stress granule cores (strain JD1370) were incubated at 0.23 A260 units/mL with 2 or 4 units of RNase H (10786357001; Roche) in 40 μL of RNase H buffer (20 mM HEPES-KOH pH 8.0 ...
-
bioRxiv - Cell Biology 2024Quote: ... After washes, the cells were stained with the DNA stain DAPI (4, 6 diamidino-2-phenylindole dihydrochloride) (Roche, #1023627001) and mounded with Prolong gold anti-fade mound media (Invitrogen ...
-
bioRxiv - Developmental Biology 2019Quote: ... third-instar larvae were dissected in PBS and incubated with 5-bromo-2’-deoxy-uridine (10 μM, Roche) for 45 min ...
-
bioRxiv - Molecular Biology 2020Quote: ... and 2 μl diluted cDNA (5 ng total RNA equivalents) were analyzed on the LightCycler 480 instrument (Roche) using two replicates ...
-
bioRxiv - Cancer Biology 2023Quote: Proliferation was measured by using 5-bromo-2’-deoxy-uridine (BrdU) labelling and detection kit (Roche, BSL, CH) as described earlier (25) ...
-
bioRxiv - Immunology 2023Quote: ... HEK293T cells were lysed in LUMIER lysis buffer (50 mM Hepes-KOH pH 7.9, 150 mM NaCl, 2 mM EDTA, 0.5% Triton X-100, 5% glycerol and Roche cOmplete™ Mini protease Inhibitor Cocktail ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.01 mg/mL insulin-transferrin-sodium-selenite solution (ITSS; Roche), and 2 μg/mL EGF (R&D Systems)] ...
-
bioRxiv - Cell Biology 2020Quote: ... 0.5% Sodium deoxycholate) supplemented with 1X complete protease inhibitor (Roche) and 250U benzonase (Sigma ...
-
bioRxiv - Developmental Biology 2021Quote: ... 0.5% sodium deoxycholate) containing a protease inhibitor cocktail (Roche, 11697498001). Protein samples were separated by SDS-PAGE and blotted onto the PVDF membranes ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1% sodium deoxycholate) containing cOmplete Protease Inhibitor Cocktail (Roche, 11697498001); then ...
-
bioRxiv - Microbiology 2019Quote: ... 0.5% sodium deoxycholate) supplemented with protease inhibitor cocktail (11873580001, Roche) and phosphatase inhibitors (1mM sodium orthovanadate ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.5% sodium deoxycholate and freshly added protease inhibitor cocktail (Roche) for 30 min on ice ...
-
bioRxiv - Cancer Biology 2020Quote: ... and 0.5% sodium deoxycholate) with complete protease inhibitor cocktail (Roche). The protein concentration was determined using a BCA Protein Assay Kit (Pierce ...
-
bioRxiv - Cancer Biology 2020Quote: ... 0.25% sodium deoxycholate) containing a cocktail of protease inhibitors (Roche). The total protein level was quantified using a BCA protein assay kit (Thermo ...
-
bioRxiv - Neuroscience 2022Quote: ... 1 mM sodium orthovanadate) containing protease and phosphatase inhibitors (Roche) derived from four LRRK2 G2019S-linked patients ...
-
bioRxiv - Cancer Biology 2022Quote: ... 1 mM sodium orthovanadate with complete protease inhibitor cocktail (Roche) as describe previously ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.5% sodium deoxycholate) and protease inhibitor cocktail supplement (Roche, 11836170001). Protein concentration was determined by bicinchoninic acid assay (Pierce ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.1% sodium dodecyl sulfate) with a protease inhibitor cocktail (Roche). Lysates were cleared by centrifugation at 16,000×g for 15 min and protein concentration was determined using a Pierce BCA assay kit (ThermoScientific ...