Labshake search
Citations for Roche :
201 - 250 of 2640 citations for 7 9 Diazaspiro 4.5 decane 6 8 10 trione 7 ethyl 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pharmacology and Toxicology 2019Quote: ... X-tremeGENE™ 9 DNA Transfection Reagent was bought from Roche Pharma (Reinach ...
-
bioRxiv - Cancer Biology 2020Quote: ... R26ERG organoids with X-tremeGENE™ 9 transfection reagent (Roche, 6365779001). After 2 days ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...
-
bioRxiv - Microbiology 2020Quote: ... Cells were seeded in 10 cm tissue-culture treated dishes and transfected with FuGENE 6® reagent (Roche) for 24 hr ...
-
bioRxiv - Biochemistry 2023Quote: ... The supernatant containing chromatin fragments was then treated with 6-10 µg/g cells DNase-free RNase (Roche) at 37°C for 30 minutes and subsequently cleared by centrifugation at 30,000 rcf for 30 minutes ...
-
bioRxiv - Genomics 2021Quote: ... After two washes with cold PBS the cells were collected in the Lysis buffer (5 mM PIPES pH 7.5, 85 mM KCl, 0.5% NP40, 20 mM N-ethyl maleimide [NEM] and protease inhibitor cocktail [04693159001, Roche]) and incubated at 4°C for 10 minutes with rotation ...
-
bioRxiv - Biochemistry 2019Quote: ... The cells were then pelleted again and resuspended in 150 μL of Lysozyme buffer (150 mM NaCl, 30 mM Tris–HCl pH 8, 10 mM EDTA, cOmplete protease inhibitor (Roche), 1 mg/ml lysozyme ...
-
bioRxiv - Biochemistry 2019Quote: ... The cells were then pelleted again and resuspended in 150 μL of Lysozyme buffer (150 mM NaCl, 30 mM Tris–HCl pH 8, 10 mM EDTA, 1 mM TCEP, cOmplete protease inhibitor (Roche), 1 mg/ml lysozyme ...
-
bioRxiv - Microbiology 2019Quote: ... The cells were washed twice with PBS and lysed with 6 ml of lysis buffer (8 M urea, 150 mM NaCl, 100 mM ammonium bicarbonate, pH 8; added per 10 ml of buffer: 1 tablet of Roche mini-complete protease inhibitor EDTA free and 1 tablet of Roche PhosSTOP tablet ...
-
bioRxiv - Genetics 2020Quote: ... and resuspended in 300 μL of Nuclei Lysis Buffer (Tris-HCl pH 8 50 mM, EDTA 10 mM, SDS 0.5% and protease inhibitor (Roche-04693132001). Nuclei were then sonicated (Diagenode bioruptor plus sonicatore ...
-
bioRxiv - Microbiology 2020Quote: ... pelleted and resuspended in 150 μl sonication buffer [(50 mM Tris pH 8, 1% SDS, 10 mM EDTA, 1x protease inhibitor (Roche)] ...
-
bioRxiv - Developmental Biology 2020Quote: ... Nuclei were pelleted by centrifugation and resuspended in sonication buffer (50 mM Tris-HCl pH 8, 1% SDS, 10 mM EDTA, 1x cOmplete ULTRA Tablet (Roche)) and sonicated using a Bioruptor sonicator (Diagenode ...
-
bioRxiv - Genetics 2019Quote: ... cells were vortexed and passed through a syringe in ubiquitin lysis buffer (2% SDS, 150mM NaCl, 10 mM Tris HCl pH 8, 1 Roche protease inhibitor tablet ...
-
bioRxiv - Cell Biology 2019Quote: ... washed in PBS, and resuspended in Lysis Buffer (Tris 10 mM pH 8, 2 mM EDTA) supplemented with Complete protease inhibitor (Roche, Merck ...
-
bioRxiv - Microbiology 2021Quote: ... before being resuspended in 1 mL of lysis buffer (100 mM NaCl, 5% glycerol, 10 mM Tris, pH 8; one cOmplete Mini EDTA-free protease inhibitor pellet (Roche) per 15 mL) ...
-
bioRxiv - Cancer Biology 2019Quote: ... 1 mM EDTA at pH 8, 10% glycerol, 1 mM DTT, 0.5 mM PMSF, 0.1 mM sodium orthovanadate, and 1X Roche protease inhibitors). Collected nuclear pellets were lysed in in 1× RIPA buffer (10 mM Tris-Cl at pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... Cell pellets were resuspended in 50 ml lysis buffer (Hepes 50 mM pH 8, 500 mM NaCl, 10 mM Imidazole, benzonase, EDTA-free protease inhibitor cocktails (ROCHE)) at 4°C and sonicated ...
-
bioRxiv - Microbiology 2023Quote: ... Bacteria were lysed in equilibration buffer (20 mM NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8) supplemented with lysozyme and anti-protease cocktail (Roche), followed by sonication ...
-
bioRxiv - Molecular Biology 2023Quote: ... Frozen cell pellets were resuspended in 300 μL of cold hypotonic buffer (10 mM Tris-HCl pH 8, 1.5 mM MgCl2, 1 mM KCl, 10X PhosphoSTOP (Roche, 4906845001), 2X Protease Inhibitor Cocktail (Roche ...
-
bioRxiv - Molecular Biology 2023Quote: ... a total of 5 μg of plasmid and dsRNA were transfected into BmN4 cells (8 × 105 cells per 10 cm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche) every 3 days four times ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The final pellet was resuspended in 750 uL nuclear lysis buffer (10 mM EDTA, 1% SDS, 50 mM Tris-HCl at pH 8, 1x cOmplete protease inhibitor cocktails (Roche)) ...
-
bioRxiv - Molecular Biology 2024Quote: ... and twice with TE wash buffer (10 mM Tris-HCl pH 8, 1 mM EDTA, 1x Roche protease inhibitor mixture).
-
bioRxiv - Cancer Biology 2024Quote: ... cells were disrupted in 1% NP-40 lysis buffer (140 mM NaCl, 10 mM Tris-HCl pH 8, 1% NP-40) supplemented with proteinase inhibitors (Roche). Proteins were separated by electrophoresis (SDS-PAGE) ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 μl gene specific primer mix (5 μM each) and 4.5 μl FastStart Essential cDNA Green Master (Roche) were amplified using 45 cycles of 25 s at 95 °C ...
-
bioRxiv - Systems Biology 2021Quote: ... the animals were perfused (1.5 minutes, 4.5 ml/min) with ice-cold isotonic saline containing protease inhibitors (Roche cOmplete™ Mini ...
-
bioRxiv - Developmental Biology 2021Quote: ... and developing the signal in the dark with staining solution (4.5 μl/ml NBT and 3.5 μl/ml BCIP (Roche) in NTMT buffer).
-
bioRxiv - Molecular Biology 2022Quote: ... 0.5 µl gene specific primer mix (5 µl each) and 4.5 µl FastStart Essential cDNA Green Master (Roche) were amplified using 45 cycles of 25 s at 95 °C ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA transfection was performed using X-tremeGENETM 9 DNA transfection reagent (Roche) in OptiMEM media according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... The transfection was performed using X-tremeGENE 9 DNA transfection reagent (Roche) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral helpers and constructs were transfected using X-tremeGENE 9™ (Roche) according to the manufacturer’s instructions at a 1:3 ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche, 6365787001), and 24 h later 5000 GFP+ cells were sorted into a well of six-well plate using mTeSR1 medium supplemented with 10 µM Y-27632 ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections were performed using the X-tremeGENE 9 Transfection Reagent kit (Roche) to introduce 1-2 μg of plasmid DNA as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid transfections were performed using X-tremeGENE 9 DNA transfection agent (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmids were transfected using X-tremeGENE 9 DNA transfection reagent (Roche, 6365787001) following the manufacturer’s protocol (1 μg plasmid ...
-
bioRxiv - Physiology 2022Quote: ... 150 ng of each plasmid were transfected with X-tremeGENE 9 (Roche) in C2C12 myoblasts immediately after trypsinization (47) ...
-
bioRxiv - Cell Biology 2023Quote: The TetR-eYFP tagged proteins were transfected using the XtremeGene-9 (Roche) transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE1 cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2024Quote: ... two steps of transfections were performed: DNA using XtremeGENE™ 9 (Roche) followed by siRNA (4392420-s30722 ...
-
bioRxiv - Genetics 2024Quote: ... and viral envelope vector gag-pol using XtremeGene 9 transfection reagent (Roche). Collection of viral particles and transduction was performed as described for lentiviral particles ...
-
bioRxiv - Immunology 2024Quote: ... catalog number 2708) using the X-tremeGENE 9 DNA Transfection Reagent (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection agent (Roche Diagnostics). Full-length human TREK-1(TREK-1 FL ...
-
bioRxiv - Microbiology 2020Quote: Adherent macrophages in 6-well plates were washed with PBS containing 1 mM sodium orthovanadate and 10 mM 1,10-phenanthroline (Roche) on ice prior to lysis ...
-
bioRxiv - Cell Biology 2022Quote: ... The protein lysate was electrophoresed into 6-10% SDS-PAGE gels and transferred to a PVDF membrane (Roche, 03010040001). After blocking with 5% BSA ...
-
bioRxiv - Cell Biology 2020Quote: ... cells were collected via centrifugation and resuspended in lysis buffer (40mM Tris pH 8, 300mM NaCl, 10% glycerol, 10mM imidazole, 1mM DTT, 1mM PMSF and 1x Roche PIC). Cells were lysed by sonication and after clearing the lysate ...