Labshake search
Citations for Roche :
251 - 300 of 1648 citations for 6 Amino 5 formamido uracil since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: ... Nuclei were stained with DAPI (4′,6-diamidino-2-phenylindole; 10236276001, Roche, Basel, Switzerland) for 5 minutes at room temperature ...
-
bioRxiv - Plant Biology 2022Quote: ... The glucose released was measured using the hexokinase/glucose-6-phosphate dehydrogenase method (Roche). Starch content (in glucose equivalents ...
-
bioRxiv - Plant Biology 2023Quote: ... and released glucose was assayed using the hexokinase/glucose-6-phosphate dehydrogenase assay (Roche).
-
bioRxiv - Biochemistry 2023Quote: ... DNA was stained using DAPI (4′,6-diamidino-2-phenylindol-dihydrochloride) (Roche, Mannheim, Germany). Slides were examined using an Axio Imager 7.1 microscope (Zeiss ...
-
bioRxiv - Biochemistry 2023Quote: ... 1 mM 2-Mercaptoethanol and 6 cOmplete EDTA-free protease inhibitor Cocktail tablets (Roche), pH 8.0) ...
-
bioRxiv - Biochemistry 2024Quote: ... DNA vectors were transfected using FuGENE 6 transfection reagent (Roche Applied Science, Laval, QC) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... cells were stained with 4′,6-diamidino-2-phenylindole (DAPI) (Roche, 10236276001; 1:10,000) for 5 minutes ...
-
bioRxiv - Genomics 2019Quote: ... the 5’ end of the Ppetra cDNA was determined with the 5’/3’ RACE kit 2nd generation (Roche). Reverse transcription was performed as recommended by the suppliers ...
-
bioRxiv - Molecular Biology 2019Quote: ... 25 mM Tris-HCl pH 7.4, 5 mM EDTA, 5 mM MgCl2, 1% NP-40, 0.5 mM DTT, Roche mini-tablet protease inhibitor ...
-
bioRxiv - Immunology 2020Quote: Isolated B cells from Gal9KO mice were lysed in NP40 lysis buffer (50 mM HEPES pH 8.0, 150 mM NaCl, 5 mM dithiothreitol, 5 mM EDTA, 0.1% Nonidet-P40, Roche cOmplete mini EDTA-free protease inhibitor ...
-
bioRxiv - Developmental Biology 2021Quote: ... 5 mM NaF and protease inhibitors (Roche)] ...
-
bioRxiv - Developmental Biology 2020Quote: ... and 5 μL/mL NBT (Roche, 11383213001), was then added and slides were placed at 37°C to allow colour to develop ...
-
bioRxiv - Cell Biology 2021Quote: ... 5% glycerol and protease inhibitor cocktail (Roche). The cell debris was removed from the lysate by centrifugation at 16,000 rpm for 30min ...
-
bioRxiv - Neuroscience 2020Quote: ... midazolam (5 mg/kg bodyweight; Dormicum, Roche), and medetomidine (0.5 mg/kg bodyweight ...
-
bioRxiv - Cell Biology 2021Quote: ... in 5 mg ml−1 dispase (Roche) and 0.1 mg ml−1 DNase I (Sigma ...
-
bioRxiv - Biophysics 2022Quote: ... and 5 μg of RNase A (Roche) per mg of cross-linked complex and incubated at 52 °C for 2 h ...
-
bioRxiv - Plant Biology 2022Quote: ... 5 μl of SybrGreen master mix (Roche) and 1 μl of water were processed in a LightCycler® 480 instrument (Roche ...
-
bioRxiv - Cell Biology 2022Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 5% bovine serum albumin (BSA; #10735086001, Roche)] rotating overnight at 4 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... 5% glycerol and 1x protease inhibitor (Roche)] ...
-
bioRxiv - Genetics 2024Quote: ... 5 μg/ml DNAse I (Roche 10104159001), and 0.05%Trypsin (Gibco 25200056 ...
-
bioRxiv - Cell Biology 2024Quote: ... and blocked in 5% BSA (Roche, 10735086001) in PBS solution ...
-
bioRxiv - Developmental Biology 2019Quote: ... BMP4 and 6 were prepared by in vitro transcription (DIG RNA labeling kit; Roche Diagnostics). Plasmids to generate cRNA probe for Smad4 was gifted by Prof ...
-
bioRxiv - Neuroscience 2020Quote: ... sections are incubated with DAPI (4′,6-diamidino-2-phenylindole, Cat. no. 10236276001 Roche, Switzerland) for 10 minutes at room temperature ...
-
STARCH SYNTHASE 4 is required for normal starch granule initiation in amyloplasts of wheat endospermbioRxiv - Plant Biology 2021Quote: ... Glucose was measured in the supernatant using the hexokinase/glucose-6-phosphate dehydrogenase assay (Roche), for calculation of starch content in glucose equivalents ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmids were introduced into HEK293T cells using the FuGENE 6 transfection reagent (Roche Applied Science). Cells were selected with puromycin (1 μg/ml) ...
-
bioRxiv - Genetics 2022Quote: ... sections were incubated with DAPI (4′,6-diamidino-2-phenylindole dihydrochloride, Roche, 1:250 dilution) for 10 sec and washed in PBS.
-
bioRxiv - Genetics 2022Quote: ... PCR was performed in 12 μL containing 6 μL Kapa HRM-Fast Master mix (Roche), supplemented with 1.5 mM MgCl2 ...
-
bioRxiv - Cell Biology 2023Quote: ... Transfection of HEK-293 cells was performed with FuGene 6 transfection reagent (Roche, Mannheim, Germany) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and the released glucose was assayed using the hexokinase/glucose-6-phosphate dehydrogenase assay (Roche). For mature grains ...
-
bioRxiv - Neuroscience 2023Quote: qPCR was performed on a QuantStudio 6 Flex using the SYBR Green Master mix (Roche). In all cases ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cell nuclei were counterstained with 4’,6-diamidino-2-phenylindole (DAPI, 1 μg/mL, Roche). To reduce autofluorescence ...
-
bioRxiv - Molecular Biology 2024Quote: ... Nuclear pellets were washed once with 4′,6-Diamidine-2′-phenylindole dihydrochloride (DAPI) (Roche, 10236276001) in methanol (1 μg/ml) ...
-
bioRxiv - Cancer Biology 2019Quote: ... the cell pellets were resuspended in lysis buffer (25 mM Tris-HCl pH 7.5, 150 mM NaCl, 1 % NP-40, 5 mM MgCl2, 5 % glycerol and protease inhibitor cocktail [Roche]) and incubated for 20 min at 4 °C with end-over-end rotation ...
-
bioRxiv - Plant Biology 2020Quote: ... 150 mM NaCl, 5 mM EDTA, 5 mM EGTA, 0.1% Triton X-100, 1 mM PMSF, 1x protease inhibitor cocktail [Roche] ...
-
bioRxiv - Cell Biology 2021Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche cOmplete EDTA-free protease inhibitor catalog # 11872580001) ...
-
bioRxiv - Microbiology 2019Quote: ... pH 7.4, 150 mM NaCl, 5 mM EDTA, 5% glycerol, 1% Triton X-100, and 1x complete protease inhibitor [Roche]). Cleared lysates were then incubated with glutathione sepharose (GE healthcare ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analysed on a LC480 instrument (Roche).
-
bioRxiv - Cancer Biology 2021Quote: ... 0.25 μl forward (5 μM, IDT) and 0.25 μl reverse primer (5 μM, IDT) and was analyzed on a LC480 instrument (Roche).
-
bioRxiv - Genetics 2021Quote: ... and the cell pellet resuspended in cold lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5% NP-40, 1% Triton X-100, cOmplete protease inhibitor cocktail, Roche) and incubated on ice for 30 minutes ...
-
Species-specific protein-protein interactions govern the humanization of the 20S proteasome in yeastbioRxiv - Genetics 2022Quote: ... resuspended in 10 ml buffer A (50 mM Tris pH 7.5, 150 mM NaCl, 10% glycerol, 5 mM MgCl2, 5 mM ATP, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Plant Biology 2023Quote: ... 5% glycerol, 50mM KCl, 5 mM EDTA, 0.1% Triton X-100, 5 mM DTT and 1 × protease inhibitor cocktail [Roche]). The homogenized lysates were incubated at 4 °C for 1 hour for western blot analysis of eIFiso4G1 or overnight for mass spectrometry analyses with 50 µl of prewashed immobilized γ-aminophenyl-m7GTP (C10-spacer)-agarose beads (Jena Bioscience) ...
-
bioRxiv - Microbiology 2023Quote: ... blocked in 5 % milk and probed with α-GFP (1:1,000 in 5 % milk; Roche Diagnostics GmbH, Mannheim, Germany), for GFP-based sensor probing ...
-
bioRxiv - Biochemistry 2023Quote: ... after removal of the medium cells were lysed in 1 mL of lysis buffer (50 mM Hepes [pH 8.0], 150 mM NaCl, 1 mM DTT, 5 mM MgCl2, 5 % Glycerol, supplemented with 0.55 % Nonidet P40 substitute [Roche] and cOmpleteTM EDTA-free Protease Inhibitor Cocktail [Roche]) ...
-
bioRxiv - Cancer Biology 2021Quote: ... the amplified cDNA libraries were further amplified with Target Site-specific primers containing Illumina-compatible adapters and sample indices (oDYT023-oDYT038, forward:5′CAAGCAGAAGACGGCATACGAGATNNNNNNNNGTCTCGTGGGCTCGGAGA TGTGTATAAGAGACAGAATCCAGCTAGCTGTGCAGC; reverse:5′-AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCTTTCCCTACACG ACGCTCTTCCGATCT; “N” denotes sample indices) using Kapa HiFi ReadyMix (Roche), as described in (Jones et al.) ...
-
bioRxiv - Plant Biology 2020Quote: ... and proteins were extracted in protein extraction buffer (50 mM Tris-HCl pH 7.5, 150 mM NaCl, 10 % glycerol, 2 mM EDTA, 5 mM DTT, 1 × EDTA-free Complete Protease Inhibitor Cocktail [Roche, USA] ...
-
bioRxiv - Biochemistry 2022Quote: Trophozoite stage Hyp1-Nluc parasites at 1% parasitaemia were pelleted by centrifugation at 500g and lysed in 450x pellet volume hypotonic buffer (10 mM Tris-phosphate, 5 mM EDTA, 5 mM DTT, 1x complete protease inhibitor cocktail (Roche) pH 7.4 ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...