Labshake search
Citations for Roche :
1 - 50 of 3310 citations for 26S Proteasome Non ATPase Regulatory Subunit 10 PSMD10 Antibody since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Bioengineering 2023Quote: ... supplemented with 10 % glycerol and a proteasome inhibitor (Roche) was added ...
-
bioRxiv - Cell Biology 2020Quote: ... containing complete proteasome inhibitor (Roche) and 10 μg/ml PMSF ...
-
bioRxiv - Microbiology 2022Quote: ... 0.5% NP40 containing proteasome inhibitors (Roche). Lysates were analyzed by SDS-PAGE using standard techniques ...
-
bioRxiv - Cell Biology 2020Quote: ... EDTA-free Proteasome Inhibitor Cocktail Tablet (Roche) and phosphatase inhibitor tablet (PhosSTOP EASYpack ...
-
bioRxiv - Cell Biology 2019Quote: ... and 1× Complete proteasome inhibitors (Roche, 4693132001)) and lysed (15min ...
-
bioRxiv - Molecular Biology 2021Quote: ... washed in cold PBS and incubated on ice in cold swelling buffer (10 mM Tris-HCl pH 8, 10 mM NaCl, 0.2% NP-40, 1 mM AEBSF and 1x complete mini EDTA-free proteasome inhibitor, Roche) for 10 min ...
-
bioRxiv - Genomics 2022Quote: ... Targeted exome capture was performed with custom addition of 50 Mb regulatory regions (Roche NimbleGen, Wilmington, MA), sequencing libraries were generated and then run on the Illumina HiSeq 2000 system (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... CD45 was stained (clone 2B11&PD7/26, Roche, #5269423001) to identify immune cells ...
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Cancer Biology 2023Quote: ... was diluted in Prep kit 26 (783-2876, Roche, Basel, Switzerland) and incubated for 1h ...
-
bioRxiv - Molecular Biology 2021Quote: ... 1% NP-40, 0.5% Na-deoxycholate, 0.1% SDS, 1 mM AEBSF and 1x complete mini EDTA-free proteasome inhibitor, Roche) and sonicated for 90 min ...
-
bioRxiv - Neuroscience 2020Quote: ... CAD5 cells were incubated with (0.01%) non-infectious brain homogenate (10% w/v in 0.32M sucrose) to control for efficient proteinase K (PK) (Roche) digestion and to compute the background of the assay ...
-
bioRxiv - Developmental Biology 2021Quote: ... samples were pooled by stage and underwent three rounds of centrifugation at 1500rcf at 4°C for 10 minutes followed by rehydration with DPBS with 0.5% non-acetylated BSA and 0.5U/μl RNAse inhibitor (Roche 3335399001).
-
bioRxiv - Cell Biology 2022Quote: ... Non-bound antibodies were washed with PBS-T and then the slides were incubated with anti-HA (Roche) and anti-rat IgG::FITC (Life Technologies ...
-
bioRxiv - Microbiology 2020Quote: ... non-EDTA protease inhibitor (Roche, USA) and 100 mM PMSF (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2019Quote: ... was designed to tile a 250 bp capture region within the central 4-kb target region from each 10-kb window of hg19 avoiding non-specific sequences by Roche so that the maximum distance between 2 capture regions is 14-kb ...
-
bioRxiv - Neuroscience 2023Quote: ... then lysed on ice for 15 minutes in non-denaturing lysis buffer (150 mM KCl, 10 mM MgCl2, 5mM HEPES, 1% IGEPAL) supplemented with protease inhibitors (Roche Complete EDTA-free ...
-
bioRxiv - Cell Biology 2022Quote: ... 1 mM DTT, 2 μM MG-132 proteasome inhibitor (#S2619, SelleckChem) and cOmplete® ULTRA EDTA-free inhibitor cocktail (#5892953001, Roche). Approximately 0.1 ml of 0.6 mm glass beads were added and thoroughly mixed ...
-
bioRxiv - Developmental Biology 2022Quote: ... Antibodies were used in MABT/10% horse serum/10% Western Blocking Reagent (Sigma-Roche) at a concentration of 1:2000 for anti-digoxigenin-POD (Sigma-Roche #11207733910 RRID ...
-
bioRxiv - Plant Biology 2023Quote: Proteasome activity was measured by spectrofluorometry using the 7-amino-4-methylcoumarin (AMC)-labeled fluorogenic substrate succinate-LLVY-AMC (Roche Sigma-Aldrich) in cleared extracts of leaf 1 at different dpg (Üstün and Börnke ...
-
bioRxiv - Immunology 2020Quote: ... Membranes were blocked for 1 h with 3% (w/v) non-fat milk powder in PBS/0.1% (v/v) Tween (PBST) (CALR, 10% Roche WBR in PBST) and incubated with primary antibody (Supplementary Table III ...
-
bioRxiv - Pathology 2020Quote: ... Microwave decloaking was performed in 10 mM sodium citrate (pH 6.0) and non-specific sites were blocked in TBSTw containing 1% Blocking Reagent (Roche Diagnostics, Indianapolis, IN), 5% normal goat or donkey sera ...
-
bioRxiv - Microbiology 2022Quote: ... the non-specific competitor Poly dI dC (Roche) was added to each reaction before the probe at a final concentration of 2.5 ng/µl (52) ...
-
bioRxiv - Microbiology 2023Quote: ... the non-specific competitor poly-dI-dC (Roche) was added to the EMSA reactions at a final concentration of 2.5 ng/µL ...
-
bioRxiv - Molecular Biology 2020Quote: ... followed by resuspension in 1 volume of Buffer C (5 mM Hepes pH 7.9, 26% glycerol, 1.5 mM MgCl2, 0.2 mM EDTA, 1xPIC (Roche) and 0.5 mM DTT ...
-
bioRxiv - Developmental Biology 2022Quote: ... Antibodies were used in TNTx/10% horse serum (Roche, Basel Switzerland) at a concentration of 1:2000 for anti-DIG-POD (Roche ...
-
bioRxiv - Synthetic Biology 2021Quote: Non-amyloidal samples were treated with protease inhibitor (Roche complete) before fractions separated and harvested ...
-
bioRxiv - Zoology 2021Quote: ... a fragment of the EHP small subunit ribosomal RNA (SSU rRNA) gene was used to generate an EHP probe with a PCR-DIG labeling kit (Roche, Germany) ENF779 and ENR779 (Tangprasittipap et al. ...
-
bioRxiv - Molecular Biology 2019Quote: ... Immunoprecipitation was performed using 10 µg of anti-GFP antibody (Roche, 11814460001) (used for Hap2-GFP IP ...
-
bioRxiv - Bioengineering 2020Quote: Western blotting was performed as previously reported.[26] Protein extracts were prepared using RIPA buffer containing EDTA protease (Roche Applied Science) and phosphatase inhibitors (Phostop Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... and 1.2 μl of KAPA HiFi Non-Hot Start Master Mix (Kapa Biosystems) using 12 amplification cycles ...
-
bioRxiv - Cell Biology 2023Quote: ... and non-fasting glucose concentrations were monitored weekly using Accu-Check glucometer (Roche). Plasma and islet insulin and proinsulin concentrations were measured by commercial ELISA kits (10-1247-01 and 10-1232-01 ...
-
bioRxiv - Genetics 2021Quote: ... 0.1% BSA and incubated with antibodies (10 µL anti-GFP (1:1000, Roche ref:11814460001)/50 µL beads ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were incubated for 10 min at 37°C with anti-HA antibody (3F10; Roche) (1:3000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... All human cell lines were provided by the Roche Non-Clinical Biorepository from Roche Basel or the Roche-Innovation Center Zurich (RICZ) ...
-
bioRxiv - Cell Biology 2022Quote: ... The membranes were blocked in 5% non-fat milk or 5% Casein (Roche Diagnostics) in Tris-buffered saline with 0.1% Tween (TBS-T ...
-
bioRxiv - Genomics 2022Quote: ... fourteen non-coding regions of interest were PCR amplified from human genomic DNA (Roche) using the Phusion High-Fidelity PCR Kit (NEB) ...
-
bioRxiv - Cell Biology 2020Quote: ... [U-13C]palmitate was first non-covalently conjugated to ultra fatty acid free BSA (Roche) as previously described (Vacanti et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... The embryos were then transferred to TBST containing 10% HISS and anti-DIG-AP antibody (Roche, 11093274910) at a dilution of 1:2000 overnight at 4C with constant rocking ...
-
bioRxiv - Genomics 2023Quote: ... (d) Remaining 9/10 of sample is immunoprecipitated with 1:1000 anti-HA antibody (0.1mg/mL Roche Rat Anti-HA High Affinity [11867423001] ...
-
bioRxiv - Biochemistry 2020Quote: ... Non-homologous repair efficiency was evaluated by Sanger Sequencing using KAPA2G Taq polymerase (Kapa Biosystems #KK5601) and Big Dye protocol (Life Technologies #4337451) ...
-
bioRxiv - Neuroscience 2023Quote: Cells were lysed in non-denaturing lysis buffer supplemented with EDTA-free protease inhibitor cocktail (Roche) on ice ...
-
bioRxiv - Cell Biology 2021Quote: ... Supernatant was separated from lysates by centrifugation at 20,000xg for 10 minutes and used for immunoprecipitation using 20μg of anti- GFP antibody (Roche) coupled to 50μl of Protein G Dynabeads (Life Technologies ...
-
bioRxiv - Cancer Biology 2021Quote: ... 5μL of 5uM non reading primer (5’- ACTGGAGTTCAGACGTGTGCTCTTCCGATCTCTAGGGCAGACAGATAACAG) and 0.7μL of Expand Long Template polymerase (Roche #11759060001). PCR cycling program used ...
-
bioRxiv - Molecular Biology 2019Quote: ... Supernatant was separated from lysates by centrifugation at 20,000×g for 10 minutes and used for immunoprecipitation using 20 µg of anti-GFP antibody (11814460001, Roche) (used for GFP-CENP-ACnp1 and Hap2-GFP IP ...
-
bioRxiv - Neuroscience 2020Quote: ... and then incubated for in donkey anti-mouse FITC antibody diluted in 10 X blocking buffer (1:100; Roche) + 0.3 % Triton-X100 for 1 h ...
-
bioRxiv - Neuroscience 2021Quote: ... The sections were blocked in 10% inactivated sheep serum for 1 h followed by overnight incubation with 1:1000 anti-digoxygenin (DIG) antibody (Roche). The sections were washed in PBT and incubated with NBT/BCIP (Roche ...
-
bioRxiv - Molecular Biology 2019Quote: ... and between WT mice treated with either 10 mg/kg of a functional blocking antibody against CDH11 (SYN0012; used with permission from Roche) or an isotype control antibody (IgG2a) ...
-
bioRxiv - Neuroscience 2021Quote: ... neurons were incubated live for 10 min at 37 °C with anti-HA rat monoclonal antibody (1:100, 11867423001, Roche) or anti-GFP mouse monoclonal antibody (1:200 ...
-
bioRxiv - Developmental Biology 2021Quote: ... and incubated with α-DIG or α-fluorescein antibody conjugated with alkaline phosphatase (Roche, 1:2000 in 10% FBS/PBST) at 4°C overnight ...