Labshake search
Citations for Roche :
4801 - 4850 of 6311 citations for 1 1' Diethyl 4 4' bipyridinium dibromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris-HCl pH 8.0, 0.25% IGEPAL CA-630, 1 mM DTT, 5 mM MgCl2, cOmplete protease inhibitor by Roche). Per replicate and construct ...
-
bioRxiv - Cell Biology 2022Quote: ... 50 mM Tris-HCl pH 7.5, 0.5% IGEPAL CA-630, 5 mM MgCl2, 1 mM DTT, 1x protease inhibitor EDTA free [Roche]) and mixed with 50 µL PBB-buffer-equilibrated MyOne Streptavidin C1 Dynabeads (Thermo Scientific) ...
-
bioRxiv - Biophysics 2022Quote: ... Isolated membrane fractions were diluted 1:2 in buffer EXT supplemented with protease inhibitors (Roche cOmplete EDTA-free) and 1% (w/v ...
-
bioRxiv - Cancer Biology 2023Quote: ... tissue slides were heat pre-treated using a Cell Conditioning Buffer 1 (pH 8) (Roche Diagnostic, Meylan, France) at 98°C ...
-
bioRxiv - Cell Biology 2023Quote: ... 150 mM NaCl, 1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 2x Complete EDTA-free protease inhibitor [Roche]), and insoluble material and lipid were cleared by centrifugation at 16,000 g for 15 min at 4 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were transfected with 1 µg/mL plasmid DNA using Fugene HD transfection reagent (Roche Diagnostics, Indianapolis, IN).
-
bioRxiv - Genomics 2023Quote: ... treated at 55°C and then pre-cleared with 1:2 KAPA Pure beads (Roche Cat. No: 07983298001). The quality and quantity of fragmented DNA were verified using agarose gel (1.5% ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... planulae were washed twice with 1/3 strength artificial seawater and incubated with 50 μg/mL liberaseTM (Roche) at 37 °C for 10–20 min with occasional pipetting ...
-
bioRxiv - Cell Biology 2023Quote: ... 1.5 mM MgCl2, 0.34 M sucrose, 10% glycerol, 1 mM DTT, 50 mM sodium fluoride, protease inhibitors [Roche]). Triton X-100 (0.1% ...
-
ENGRAILED-1 transcription factor has a paracrine neurotrophic activity on adult spinal α-motoneuronsbioRxiv - Neuroscience 2023Quote: ... 50 mM Tris-HCl pH8.0, 0.3 M NaCl, Triton X-100 1%, EDTA-free Complete Proteases inhibitor cocktail from Roche and 250U/ml of benzonase endonuclease from Sigma) ...
-
bioRxiv - Biochemistry 2023Quote: ... pCW57.1_yeastAOX 32 with the Delta-Vpr packaging plasmids and the VSV-G envelope plasmid (DNA concentration ratio, 1.2: 1: 0.3) into HEK293T cells using X-tremeGENE 9 Transfection Reagent (Roche). Lentivirus-containing media was harvested at 24 hr after fresh media change ...
-
bioRxiv - Cell Biology 2023Quote: ... spun at 20,000 × g for 5 min was mixed with 75 μl of RNA pulldown buffer (1× PBS, 0.1% Triton X-100, 0.6 mM PMSF, and complete EDTA-free protease inhibitor cocktail [Roche]) (final protein concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... The NEs were diluted with IP buffer (1× PBS, 0.1% Triton X-100, 0.6 mM PMSF, and cOmplete EDTA-free protease inhibitor cocktail [Roche]) (protein concentration ...
-
bioRxiv - Cell Biology 2023Quote: ... the coverslips were incubated with 1× blocking solution (Blocking Reagent [Roche] and TBST [TBS and 0.1% Tween 20]) at room temperature for 1 h ...
-
bioRxiv - Cell Biology 2022Quote: ... The supernatant was removed and the cell pellet washed in lysis buffer 2 (200 mM NaCl, 10 mM Tris-HCl pH 8.0, 1 mM EDTA, 0.5 mM EGTA, cOmplete protease inhibitor by Roche). Cells were taken up in sonication buffer (50 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Microbiology 2023Quote: ... 1 mM EDTA and 2 % N-lauroylsarcosine (w/v)) supplemented with Protease Inhibitors Cocktail (cOmplete ULTRA Tablets Roche). Bacterial cells were lysed with a M110-P microfluidizer (Microfluidics ...
-
bioRxiv - Biochemistry 2023Quote: ... 30% glycerol [w/vol] and bromophenol blue) and 1 µl of proteinase K (14–22 mg/ml, Roche) and incubating at 37 °C for 10 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... and lysed in NP-40 buffer (150 mM NaCL, 1% IGEPAL, 50 mM Tris-Cl p.H. 7.5) with protease inhibitor (Roche #04693132001 ...
-
bioRxiv - Immunology 2023Quote: ... Reverse transcription was performed with 1 μg of purified RNA using Transcriptor First Strand cDNA synthesis KIT (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2023Quote: ... the striatal/accumbal slices were sonicated in 300 µL lysis buffer (50 mM Tris-HCl [pH 7.5], 1 mM EGTA, 20 mM MgCl2, 500 mM NaCl, 0.5% NP-40, protease inhibitor cocktail [Roche] ...
-
bioRxiv - Genetics 2023Quote: ... Phosphorylation of Sch9 was assessed using an anti-HA 3F10 antibody (dilution: 1:2000; Roche Life Science, USA), followed by incubation with a goat anti-rat HRP-conjugated antibody (dilution ...
-
bioRxiv - Neuroscience 2023Quote: ... Beads were washed thoroughly with digitonin buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine, 1× Roche complete protease inhibitors ...
-
bioRxiv - Genetics 2023Quote: The beads were resuspended in 50 µL PCR mix including 1× HiFi HotStart Readymix (Kapa Biosystems, cat #KK2602) and 0.8 μM ISPCR oligo (AAGCAGTGGTATCAACGCAGAGT ...
-
bioRxiv - Microbiology 2023Quote: Cell lysates were harvested at indicated time points using RIPA buffer (50mM Tris pH 8, 150mM NaCl, 0.5% deoxycholate, 0.1% SDS, 1% NP40) supplemented with protease inhibitors (Roche) and phosphatase inhibitors (Roche) ...
-
bioRxiv - Microbiology 2023Quote: ... Nuclear pellets were resuspended in shearing buffer (0.1% SDS, 1 mM EDTA, 10 mM Tris-HCl pH 7.5, 1X Roche protease inhibitor ...
-
bioRxiv - Neuroscience 2023Quote: ... Bacterial pellets were collected via centrifugation at 4°C and 5,000g and resuspended in ice-cold lysis buffer (50 mM MES pH 6.8, 1 mM EGTA, 0.2 mM MgCl2, 5 mM DTT, Roche complete protease inhibitor ...
-
bioRxiv - Cell Biology 2023Quote: ... keratinocytes were lysed in 1× RIPA buffer (details) supplemented with a protease-inhibitor-cocktail (Roche, Burgess Hill, UK). Lysates were subjected to 10% SDS-PAGE ...
-
bioRxiv - Biochemistry 2023Quote: ... 2 mM DTT buffer to which was added 1 tablet of complete EDTA-free protease inhibitors cocktail (Roche). The cells were lysed by passage through an Avestin high pressure system at 45 psi ...
-
bioRxiv - Molecular Biology 2023Quote: ... Alkaline phosphatase (AP) staining was performed using anti-DIG-AP antibody (diluted at 1:1000, 11093274910; Roche Diagnostics) and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT ...
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were dewaxed and antigen retrieval was performed using Discovery Cell Conditioning 1 (Roche Tissue Diagnostic, ref. 06414575001) for 32 minutes at 95°C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Slides were dewaxed and antigen retrieval was performed using Discovery Cell Conditioning 1 (Roche Tissue Diagnostic, ref. 06414575001) for 32 minutes at 95°C.
-
bioRxiv - Biochemistry 2024Quote: ... Frozen cell pellets were resuspended in Lysis Buffer (50 mM HEPES [pH 7.5], 100 mM NaCl, 1 mM NaF, 0.1% βME with Roche EDTA-free protease inhibitor tablets ...
-
bioRxiv - Molecular Biology 2024Quote: ... then Lysis Buffer 2 (10 mM Tris-HCl pH 8.0, 200 mM NaCl, 1 mM EDTA, 0.5 mM EGTA, 1x Roche cOmplete™ ...
-
bioRxiv - Microbiology 2024Quote: HIV-1 RNA levels were measured in cell-free CSF and plasma at each site using the ultrasensitive Amplicor HIV-1 Monitor assay (versions 1.0 and 1.5; Roche Molecular Diagnostic Systems ...
-
bioRxiv - Cell Biology 2024Quote: The parasite culture was pelleted and suspended in PBS containing 1 × complete protease inhibitor cocktail (Roche, Basel, Switzerland). Saponin (at a final concentration of 0.15% ...
-
bioRxiv - Microbiology 2024Quote: ... 500mL of Buffer 1 (20mM KHEPES pH 7.9, 50mM KCl, 10% Glycerol) with a protease inhibitor tablet (Roche) was added and samples were subject to ultrasonication in a cup horn sonifier (Branson ...
-
bioRxiv - Molecular Biology 2024Quote: ... 1mM MgCl2, 0.1% NP-40, 5 mM DTT, 0.5 mM PMSF, 1× EDTA-free protease inhibitor cocktail [Roche] ...
-
bioRxiv - Molecular Biology 2024Quote: ... 50 mM Tris-HCl pH 8.0, 5 mM EDTA, 0.5 % SDS, 1#x00D7; protease inhibitor cocktail from Roche). The resulting nuclei were spun down ...
-
bioRxiv - Neuroscience 2024Quote: The following primary antibodies and reagents were used in this study: rat anti-HA (Roche, 3F10, 1/1000), rabbit anti-GFP (Invitrogen ...
-
bioRxiv - Physiology 2024Quote: ... 1% Triton X-100, 0.1% sodium deoxycholate, 1mM EDTA, 5mM MgCl2, 1mM DTT, 0.5mM PMSF, 10mM NaF, Roche PhoSTOP ...
-
bioRxiv - Plant Biology 2024Quote: ... 1mM DTT and 20 mM imidazole supplemented with 1 tablet of cOmplete™ EDTA-free protease inhibitor (Roche) per every 50 ml ...
-
bioRxiv - Plant Biology 2024Quote: ... Tissues were ground with mortor and pestle and resuspended in 30 mL extraction buffer 1 (10 mM Tris-HCl, pH 8.0, 5 mM βmercaptoethanol, 0.4 M sucrose, protease inhibitor cocktail (cOmplete, Roche), vortexed ...
-
bioRxiv - Cell Biology 2024Quote: ... Membranes were incubated in primary antibody diluted in blocking buffer [rat anti-HA HRP 1:500 (Roche 12013819001), mouse anti-tubulin 1:1000 (Sigma ...
-
bioRxiv - Cell Biology 2024Quote: ... washed with cold PBS and then lysed for 4 hours on rotation at 4°C in TNEN buffer (50 mM Tris pH 7.5, 1 mM EDTA, 150 mM NaCl, 0.1% NP-40, Protease inhibitors (Roche) and phosphatase inhibitors (Sigma ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... was diluted 10-fold with ChIP incubation buffer (70 mM NaCl, 10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 2 mM EDTA, 0.1% Triton, 1 x Roche Complete EDTA-free Protease inhibitor cocktail) ...
-
bioRxiv - Immunology 2024Quote: ... followed by a subsequent incubation at 95 °C in pre-formulated Cell Conditioning 1 solution (Roche Diagnostics, Canada). Following this ...
-
bioRxiv - Plant Biology 2024Quote: ... supplemented with 1 tablet of protease inhibitor cocktail per 10 ml buffer (cOmplete™ Proteasehemmer-Cocktail, ©Roche) with an ultrasonic homogenizer (Hielscher Ultrasonics UP200St ...
-
bioRxiv - Biochemistry 2024Quote: ... HA- and GFP-tagged proteins were detected using horseradish peroxidase-conjugated monoclonal anti-HA (Roche, 3F10, 1:5,000) and anti-GFP (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reactions were stopped by adding 0.5 μl ethylenediaminetetraacetic (0.5 M EDTA) and 1 μl Proteinase K (19 mg/ml, Roche), and incubated at 50°C for 30 min ...
-
bioRxiv - Cancer Biology 2024Quote: ... and 72°C for 1 min) All PCR was performed using KAPA HiFi HotStart ReadyMix (Kapa Biosystems; KK2602). The PCR products were isolated by QIAquick PCR Purification Kit (Qiagen ...