Labshake search
Citations for Roche :
401 - 450 of 5646 citations for Rat Golgi phosphoprotein 3 GOLPH3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The membrane was then stripped and incubated with rat anti-HA primary antibody (Roche) at 1/2000 dilution in PBST 5% milk and washed 3 times ...
-
bioRxiv - Biochemistry 2023Quote: ... the blots were probed with HRP-conjugated rat anti-HA antibody (clone 3F10, Roche) at a 1:1000 dilution and incubated overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... membranes were incubated overnight with primary antibodies: rat monoclonal anti-HA (1:1000, ROCHE), or Actin5c (1:200 ...
-
bioRxiv - Cell Biology 2023Quote: ... proteins were transferred onto nitrocellulose membranes and probed with rat α-HA (3F10, Roche), rabbit α-Myc (Cell Signaling) ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 uL of DNaseI (10U/ul Roche), 8 uL buffer (200 mM Tris ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for target enrichment of ∼3 Mb of Lupinus angustifolius genomic material were produced using the Roche Sequencing Solutions’ ‘SeqCap EZ – HyperPlus’ kit (Roche Sequencing Solutions, Pleasanton, CA) with 200 ng/L of input DNA.
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Cell Biology 2019Quote: ... The lysates were incubated with 30 μl pre-washed rat anti-HA Affinity Matrix (Roche) for 3 h at 4°C ...
-
bioRxiv - Cell Biology 2020Quote: ... was used for staining Cse4-GFP and rat anti-HA (1:200 dilution: Roche, 11867423001) for Mad2-3HA staining as primary antibodies ...
-
bioRxiv - Neuroscience 2021Quote: ... the rats’ fasting blood glucose (FBG) was measured with a glucose meter (Roche, Basel, Switzerland). The serum levels of insulin (80-INSRT-E01) ...
-
bioRxiv - Cell Biology 2019Quote: ... The antibodies used for IFA were: rat anti-HA antibody (clone 3F10; Roche, 1:100), mouse anti-AMA1 (1F9 from Alan Cowman) ...
-
bioRxiv - Synthetic Biology 2019Quote: ... The HA-tagged tdnano construct was stained using a rat α-HA primary antibody (Roche) and an Alexa Fluor 647-conjugated secondary antibody (Thermo Fisher) ...
-
bioRxiv - Cell Biology 2021Quote: ... The primary antibody and dilution used was rat anti-HA-HRP 3F10 (Roche Applied Science), 1:2500-1:5000 ...
-
bioRxiv - Neuroscience 2020Quote: ... Cells were incubated overnight at 4 °C with rat anti-HA antibody (1:500 - Roche) and then with secondary goat anti-rat IgG antibody coupled to Alexa 568 (Invitrogen/Life Technologies ...
-
bioRxiv - Developmental Biology 2021Quote: ... The following primary antibodies were used: Rat@HA (Roche 11 867 423 001, 1:500). Mouse@c-Myc9E10 (Santa Cruz sc-40 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Pre-cleared extracts were incubated with 1 μg rat monoclonal anti-HA (Roche, Mannheim, Germany) for 2 h at 4 °C ...
-
bioRxiv - Microbiology 2020Quote: ... Slides were incubated with rat anti-HA high-affinity (1:1000 dilution; Roche, clone 3F10) at room temperature for 30 min ...
-
bioRxiv - Cell Biology 2021Quote: ... Primary antibodies used under heat fixation were anti-HA (rat monoclonal, 3F10; 1:500; Roche), anti-Canoe (rabbit 1:1000 ...
-
bioRxiv - Cancer Biology 2019Quote: ... The following reagents were used for visualization: DISCOVERY OmniMap anti-Rat HRP (Roche,760-4457) for CD31 or OmniMap anti-Rabbit HRP (Roche ...
-
bioRxiv - Plant Biology 2022Quote: ... For the detection of Pm8-HA anti-HA-HRP antibody (rat monoclonal, clone 3F10, Roche) was used at a dilution of 1:3000 ...
-
bioRxiv - Biophysics 2023Quote: Lyophilized collagen containing telopeptides (Type I collagen from rat tail tendon, Roche cat. no. 11179179001) was purchased from Sigma Aldrich ...
-
bioRxiv - Developmental Biology 2023Quote: The primary antibodies used in this study included anti-HA (rat, 1:200; 11867423001, Roche), anti-Prestin (goat ...
-
bioRxiv - Microbiology 2024Quote: ... the membranes were probed with rat anti-HA high affinity (clone 3F10, Roche, 1:1,000) and rabbit anti-GAP5085 (a gift from Julian Rayner ...
-
bioRxiv - Developmental Biology 2022Quote: ... The incorporation of BrdU was then measured by ELISA at 24h per the manufacturer’s protocol (Roche Diagnostics, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...