Labshake search
Citations for Roche :
651 - 700 of 5646 citations for Rat Golgi phosphoprotein 3 GOLPH3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Neuroscience 2021Quote: ... at the ratio of 1:3 using X-tremeGENE HP DNA Transfection Reagent (Roche) following the manufacturer’s recommended protocol ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Genomics 2021Quote: Probes 1-3 were labelled with digoxigenin-11-dUTP or biotin-11-dUTP (Roche) using BioPrime® Array CGH ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Physiology 2023Quote: ... and 0.165 mg/mL BCIP (5-Bromo-4-chloro-3-indolyl phosphate, Roche, 11383221001) in alkaline phosphatase buffer ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Immunology 2023Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Developmental Biology 2024Quote: ... and 400nM 5-Bromo-4-chloro-3-indolyl phosphate p-toluidine salt (BCIP, Roche).
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Bioengineering 2021Quote: ... The blood glucose levels of ZDF rats in each group were measured using a digital glucose meter and test strips (Accu-Chek® Sensor, Roche Inc., Mannheim, Germany) 2 or 3 days prior to surgery and at the study endpoint ...
-
bioRxiv - Cell Biology 2020Quote: ... membranes were incubated for at least 1 h with a 1:1000 dilution of a high affinity anti-HA antibody from rat IgG1 (#11867423001, Roche Applied Science, Penzberg, Germany). Detection was carried out by incubating with a 1:4000 dilution of a rabbit anti-rat antibody conjugated to peroxidase (A5795 ...
-
bioRxiv - Developmental Biology 2020Quote: Ovaries and testis were fixed and stained according to standard procedures with the following primary antibodies: rat anti-HA (1:500, Roche cat# 11867423001, RRID: AB_390919), rat anti-Vasa (1:100 ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... and Nitro Blue tetrazolium/5-bromo-4-chloro-3-indolyl-phosphate NBT/BCIP (Roche Diagnostics). In situ hybridizations were based on the Carroll lab “Drosophila abdominal in situ” protocol (http://carroll.molbio.wisc.edu/methods.html ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Neuroscience 2020Quote: ... which were stained with 5-bromo-4-cloro-3-indlyl phosphate/nitro blue tetrazolium (Roche) chromogenic substrates.
-
bioRxiv - Developmental Biology 2020Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained embryos and gonads were embedded in gelatin ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then pelleted and washed 3 times with PBS containing protease inhibitor (Roche, 11873580001). The pellets were snap-frozen and stored at -80°C for later use ...
-
bioRxiv - Neuroscience 2020Quote: ... MgCl2 50 mM] and incubated in 5-bromo-4-chloro-3-indolyl-phosphate (BCIP) (Roche) and 4-nitro blue tetrazolium chloride (NBT ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Microbiology 2019Quote: ... frozen pellets were thawed and resuspended in 1 ml of 3 mg/ml lysozyme (Roche) and 0.4 mg/ml proteinase K (Ambion ...
-
bioRxiv - Developmental Biology 2020Quote: ... and then incubated in nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate solution (Roche).
-
bioRxiv - Neuroscience 2020Quote: ... and nitro-blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3′-indolyphosphate (BCIP) substrate (Roche) according to published protocols ...
-
bioRxiv - Neuroscience 2020Quote: ... followed by NBT/BCIP (nitroblue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate) reaction (Roche). After in situ hybridization ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were lysed at 3 days in ice-cold RIPA buffer containing protease inhibitors (Roche) and protein concentration was determined by BCA Assay (Gibco BRL ...
-
bioRxiv - Genomics 2019Quote: ... beads were washed 3×1mL with bead wash buffer (1x PBS, 5mg/mL BSA, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Cell Biology 2021Quote: ... in the presence of nitro blue tetrazolium/5-bromo-4-chloro-3′-indolyphosphate substrates (Roche). Stained testicular explants were embedded in gelatin ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Physiology 2023Quote: ... 3 µL of Light Cycler 480 SYBR® Green I Master mix (Roche Diagnostics, Switzerland), 0.24 µL of each primer (10X ...
-
bioRxiv - Neuroscience 2023Quote: ... and 0.17 mg/mL 5-bromo-4-chloro-3-indolyl-phosphate (BCIP; Roche, Basel, Switzerland) at room temperature for 1 h (Brn3acKOAP/cKOAP mice ...
-
bioRxiv - Genomics 2023Quote: ... For 3-color detection the following antibody dilutions were made: anti-digoxigenin (Roche, cat. 11333089001) 1:10 ...
-
bioRxiv - Developmental Biology 2024Quote: ... NBT/BCIP (4-nitro blue tetrazolium chloride/5-bromo-4-chloro-3-indolylphosphate, Roche, 11681451001) was added after thoroughly washing samples ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Microbiology 2020Quote: ... and the Library Quantification Kit – Illumina/Universal Kit (KAPA Biosystems) quantified the prepared libraries ...
-
bioRxiv - Genetics 2020Quote: ... PCR KIT (Roche). For each reaction ...
-
bioRxiv - Cell Biology 2019Quote: ... 3) 2hr RT incubation in blocking solution (5% Sheep Serum, 1% Roche Blocking Buffer in PBST); 4 ...
-
bioRxiv - Neuroscience 2019Quote: ... and 5-bromo-4-chloro-3-indolyl phosphate/nitro blue tetrazolium (BCIP/NBT) substrate (Roche Diagnostics). Color development was allowed to proceed overnight or was stopped after 2-3 hours (for quantification of npba expression in Vs/Vp ...
-
bioRxiv - Neuroscience 2020Quote: ... The colometric reaction was performed using mixture of 5-Bromo-4-chloro-3-indolyl phosphate (Roche) and Nitro blue tetrazolium chloride (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... and BCIP (5-Bromo-4-chloro-3-indolyl phosphate)-NBT (nitro blue tetrazolium) chromogenic substrates (Roche). Images were captured by Apotome2 Zeiss microscope system.
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...