Labshake search
Citations for Roche :
401 - 450 of 2670 citations for 7 Bromo 4 chlorothieno 3 2 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Microbiology 2020Quote: ... NimbleGen 4-plex arrays containing 4 × 72,000 arrays per slide were used (Roche, Mannheim, Germany). Construction of this chip was initially based on combining two previous genome annotations (Amselem et al. ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg of plasmid and 4 μl of X-tremeGENE HP DNA Transfection Reagent (Roche) were used per well ...
-
bioRxiv - Microbiology 2021Quote: ... and 100 U/mL human interleukin 2 (IL-2) (Roche) (Munoz et al. ...
-
bioRxiv - Microbiology 2021Quote: ... 2 M CaCl2 and 2 UU/ml DNAse I (Roche) for 30 min at 37°C ...
-
bioRxiv - Biophysics 2019Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche).
-
bioRxiv - Biophysics 2021Quote: ... 2 mM MgCl2) supplemented with 2 protease inhibitor tablets (Roche), 1 mM PMSF ...
-
bioRxiv - Immunology 2023Quote: ... and 30 IU/mL human interleukin-2 (hIL-2) (Roche). To ectopically express Lifeact-eGFP or Lamp1-eGFP in CTLs ...
-
bioRxiv - Cancer Biology 2020Quote: ... grade 2 (Roche), homogenizing for 20min with a plastic Pasteur pipette ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2022Quote: ... in deionized phosphate-buffered saline (PBS)] supplemented with 1:7 proteases inhibitors cocktail (Roche Diagnostics GmBH, Germany) for 10 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... and 4 mg/ml dispase (Roche) in complete culture media for 15 min at 37 °C ...
-
bioRxiv - Biochemistry 2019Quote: ... 4 μg sequencing grade trypsin (Roche) was dissolved in 165 μL ice cold trypsin digestion buffer and added to resin in the spin columns with the bottom capped ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5ml of sterile collagenase D (0.5mg/ml in PBS, Roche, 11088858001) and 0.5ml of melted agarose (1% in PBS ...
-
bioRxiv - Molecular Biology 2019Quote: ... minced and digested in DMEM containing collagenase D (0.75U/ml, Roche) and dispase II (1.0U/ml ...
-
bioRxiv - Genomics 2020Quote: ... and digested with 5.4 U/mL collagenase D (Roche applied science), 100 U/mL DNase I (Sigma ...
-
bioRxiv - Physiology 2019Quote: The pericardia were enzymatically digested with 1mg/ml Collagenase D (Roche) for 35 minutes at 37°C in RPMI 1640 (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... the specimen was digested in 8 mg/mL Collagenase D (Roche) and 4.8 U/mL Dispase II (Roche ...
-
bioRxiv - Immunology 2019Quote: ... Murine omenta were enzymatically digested with 1mg/ml Collagenase D (Roche) for 35 minutes at 37°C in RPMI 1640 (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: ... Tumor fragments were digested with Collagenase D and DNase I (Roche), counted and 2×106 BC004 cells were injected in total volume of 20 µl PBS into the mammary fat pad of humanized NSG mice ...
-
bioRxiv - Cell Biology 2021Quote: ... and digested with collagenase D (5 mg/mL, #11088882001, Roche, Germany) and dispase (2 mg/mL ...
-
bioRxiv - Cell Biology 2019Quote: ... triturated into 1-5mm2 pieces and digested with collagenase D (Roche) for one hour at 37°C with agitation ...
-
bioRxiv - Immunology 2020Quote: ... were teased and digested in 2.68 mg/ml collagenase D (Roche) for 25 min at 37°C ...
-
bioRxiv - Molecular Biology 2019Quote: ... followed by the solution II (1 mg/ml collagenase D (Roche) in K-R buffer supplemented with 150 μM CaCl2) ...
-
bioRxiv - Microbiology 2020Quote: ... and then enzymatically digested with collagenase D (0.5 mg/mL, Roche) and DNAse I (0.01 mg/mL ...
-
bioRxiv - Cell Biology 2021Quote: ... and digested overnight in 0.2% (wt/v) Collagenase D (11088866001, Roche) in DMEM-F12 medium supplemented with 1% (v/v ...
-
bioRxiv - Microbiology 2021Quote: ... either with 500 μL of collagenase D (1 mg/mL) (Roche) and overnight incubation at 37°C without agitation ...
-
bioRxiv - Cancer Biology 2021Quote: ... triturated into 1-5mm2 pieces and digested with collagenase D (Roche) for one hour at 37°C with agitation ...
-
bioRxiv - Immunology 2022Quote: ... cut into small pieces and treated with collagenase-D (Roche, Merck). After 30 minutes of incubation at 37 ° C ...
-
bioRxiv - Immunology 2023Quote: ... at a concentration of 1 mg/ml and collagenase D (Roche) at a concentration of 3.75 mg/ml ...
-
bioRxiv - Microbiology 2023Quote: ... and then enzymatically digested with collagenase D (0.5 mg/mL, Roche) and DNase I (0.01 mg/mL ...
-
bioRxiv - Cancer Biology 2023Quote: ... lysed by 1 mg mL-1 Collagenase-D (Roche, Basel, Switzerland) for 10 min ...
-
bioRxiv - Neuroscience 2024Quote: ... 100 µL of homogenate were treated with (i) collagenase D (Roche) high (40U/mL ...
-
bioRxiv - Immunology 2024Quote: ... kidneys were enzymatically digested with 400 µg/ml collagenase D (Roche) and 10 U/ml DNase I (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... 2% SDS and 2 mg/ml protease inhibitor 18 (Complete, ROCHE MOLECULAR DIAGNOSTICS ...
-
bioRxiv - Cancer Biology 2022Quote: ... and human epidermal growth factor 2 (HER-2) (790–4493, Roche).
-
bioRxiv - Cell Biology 2022Quote: ... 5’-CAA GTG CAA CAG TTT CTC ATT-3’/5’-TGT TTG ACT ACA CTC ACA CT-3’) using X-tremeGENE 9 DNA Transfection Reagent (Roche). 48 hours after transfection ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...