Labshake search
Citations for Roche :
351 - 400 of 2670 citations for 7 Bromo 4 chlorothieno 3 2 d pyrimidine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... Pericardium was digested using 1mg/ml Collagenase D (Roche) in a shaking heat block at 37°C ...
-
bioRxiv - Microbiology 2021Quote: ... 0.5 mg·ml-1 Type-D Collagenase (Roche, Cat# 11088858001) at 100 rpm for 15 min at 37 °C ...
-
bioRxiv - Immunology 2022Quote: ... This cocktail contained Colleagenase D (Roche, 1 mg/ml) and DNAse I (Roche ...
-
bioRxiv - Microbiology 2022Quote: ... Chlorophenol red-beta-D-galactopyranoside (Roche Diagnostics, Indianapolis, IN) substrate was added to cell lysates ...
-
bioRxiv - Cancer Biology 2022Quote: ... and digested with 1 mg/ml collagenase D (Roche) and 100 µg/ml DNase I (Sigma ...
-
bioRxiv - Immunology 2023Quote: ... and collagenase D at 400 U ml-1 (Roche). After digestion ...
-
bioRxiv - Immunology 2023Quote: ... and collagenase D at 400 U ml-1 (Roche). pLNs were cut into small pieces and incubated for 30 min at 37 °C ...
-
bioRxiv - Immunology 2023Quote: ... supplemented with collagenase D (1 mg ml−1, Roche) and DNase I (0.25 mg ml−1 ...
-
bioRxiv - Cell Biology 2023Quote: ... and collagenase D (1 mg/mL; Roche, Basel, Switzerland) [9] ...
-
bioRxiv - Immunology 2024Quote: ... and incubated with collagenase D (1 mg/ml; Roche) in RPMI1640 medium at 37 °C for 30 min ...
-
bioRxiv - Immunology 2023Quote: ... enzymatic dissociation with 1 μg/ml Collagenase D (Roche) and 25 μg/mL DNAse I (ThermoFisher ...
-
bioRxiv - Microbiology 2023Quote: ... followed by enzymatic digestion with collagenase D (Roche 11088882001). Cells were passed through a 70 µm cell strainer ...
-
bioRxiv - Neuroscience 2024Quote: ... and collagenase D (1.4 mg/ml, Roche Life Science). After 40-min incubation under constant shaking at 34°C ...
-
bioRxiv - Immunology 2023Quote: ... and incubated with 1 mg/ml collagenase D (Roche) and 0.1 mg/ml DNase I (Roche ...
-
bioRxiv - Immunology 2019Quote: ... and hematoxylin (4 minute incubation) and Bluing Reagent (4 minute incubation) counterstain (Roche, Ventana Medical Systems ...
-
bioRxiv - Biochemistry 2022Quote: ... 3 mg/ml Dispase II (Roche), and 1 mg/ml trypsin inhibitor (Sigma-Aldrich ...
-
bioRxiv - Neuroscience 2021Quote: ... and ∼3 mg DNase I (Roche). MhOR5 was extracted using 0.5% (w/v ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% NP40 (Roche 11332473001), 3 µL 10% Tween-20 (Roche 11332465001) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and dithiothreitol (Roche, 3483-12-3). Lysates were rocked at 4C for 20 min and centrifuged 10 min at 15,000g ...
-
bioRxiv - Immunology 2023Quote: ... 3 IU/mL erythropoietin (EPO; Roche), 50 ng/mL stem cell factor (SCF ...
-
bioRxiv - Cell Biology 2019Quote: ... SEPT6/7-strep tagged was amplified with KAPA HiFi HotStart DNA polymerase (KK2502; KAPA BIOSYSTEMS) using the primers 5’-GTAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGTCGGTCAGTATGG TAGCTCAACAGAAGAA-3’ and 5’-TTCTTCTGTTGAGCTACCATACTGACCGACATATGTA TATCTCCTTCTTAAAGTTAAACAAAATTATTAC-3’ ...
-
bioRxiv - Genomics 2021Quote: ... rp49 5’-TAATACGACTCACTATAGGGCAGTAAACGCGGTTCTGCATG-3’ and 5’-CAGCATACAGGCCCAAGATC-3’) were transcribed using the Biotin RNA Labeling Mix (Roche) and T7 polymerase (Promega).
-
bioRxiv - Immunology 2023Quote: ... human interleukin-2 (IL-2) (10 IU/ml, Roche), 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES ...
-
bioRxiv - Developmental Biology 2020Quote: ... 4-toluidine salt (BCIP, Roche) in NTMT buffer ...
-
bioRxiv - Microbiology 2023Quote: ... 4 U DNase I (Roche) with the reaction buffer provided with the enzyme for 20 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 4 mM MgCl2 (Roche Diagnostics), 0.3 µM of each primer (RB1_80F and RB1_235R ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 mM Tris-HCl (pH 7) and EDTA-free protease inhibitor cocktail (cOmplete™, Roche # 11873580001). After 30 min incubation on ice ...
-
bioRxiv - Genomics 2020Quote: ... 0.1% IGEPAL CA-630)7 supplemented with protease inhibitors (Complete Protease Inhibitor Cocktail, EDTA-free, Roche). Embryos were homogenized in a Dounce homogenizer then incubated in cold lysis buffer at 4°C for 1 hour ...
-
bioRxiv - Immunology 2023Quote: ... and fractions 7–10 (cytosolic ribosomes) were pooled and treated with PCR grade proteinase K (Roche) in 1% SDS to release ribosome protected fragments ...
-
bioRxiv - Immunology 2020Quote: ... 1.7 mM chlorophenol red-β-D-galactopyranoside (CPRG, Roche #10884308001). CPRG conversion by β-galactosidase was measured by optical density at 590 nm.
-
bioRxiv - Cell Biology 2019Quote: ... Muscle were digested with 2.5 mg/ml Collagenase D (Roche) and 0.04 U/ml Dispase II (Roche ...
-
bioRxiv - Immunology 2019Quote: ... homogenized and digested with collagenase D (2.5 mg/ml, Roche), DNAse I (100 μg/ml ...
-
bioRxiv - Bioengineering 2019Quote: ... with 1 mg/mL of Collagenase D (Roche, Basel, Switzerland) and 0.1 mg/mL DNase I (Roche ...
-
bioRxiv - Neuroscience 2020Quote: ... for 25 min and collagenase D (1 mg/mL, Roche) with papain (30 U/mL ...
-
bioRxiv - Immunology 2022Quote: ... Meninges were digested with Collagenase D (Cat:11088858001, Roche, Germany) and DNase I (Cat:10104159001 ...
-
bioRxiv - Developmental Biology 2019Quote: Postnatal thymi were dissociated in 1.25mg/ml collagenase D (Roche), and subsequently in 1.25mg/ml collagenase/dispase (Roche ...
-
bioRxiv - Immunology 2020Quote: ... Digestion was performed with a 0.1% collagenase D (Roche;11088866001) and 0.2% trypsin solution (Gibco;15090-046 ...
-
bioRxiv - Immunology 2020Quote: ... Lymph nodes were treated with collagenase D (Roche, Basel, Switzerland) and DNase I (Boehringer ...
-
bioRxiv - Cancer Biology 2022Quote: ... 0.5 ml of Collagenase D (Roche, #11088866001, 1:10 dilution) and DNAseI (Stemcell #07900 ...
-
bioRxiv - Microbiology 2023Quote: ... TE Select-D G-25 spin columns (Roche Applied Science) were used to remove unincorporated [μ-32P]dATP ...
-
bioRxiv - Bioengineering 2023Quote: ... a protease solution of 2.5 mg/mL collagenase D (Roche) in PBS was prepared and added to cover the samples before incubation at 37 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 3.7U collagenase D (Roche, cat 11 088 882 001) via inferior vena cava ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Plant Biology 2019Quote: ... 3 uL of DNaseI (10U/ul Roche), 8 uL buffer (200 mM Tris ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...