Labshake search
Citations for Roche :
401 - 450 of 538 citations for 3 3 Bromomethyl phenyl thiophene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 0.05% Tween 20) before exchange of the pre-incubation solution for hybridization buffer containing 3 ng/µl of digoxigenin-labeled (Roche) riboprobe ...
-
bioRxiv - Cell Biology 2022Quote: Whole endothelial extracts were prepared from 70-80% confluent cells in lysis buffer (3% SDS, 60 mM sucrose, 65 mM Tris (pH 6.8) containing protease inhibitor cocktail (Roche-11836170001). Protein extracts were sonicated briefly and the concentration of the isolated proteins was assessed using BCA Protein Assay Reagent (Thermo Scientific™ ...
-
bioRxiv - Microbiology 2022Quote: ... The membrane was washed again with 1x TBST 3-5 times for a total of 20 min and developed using 5-bromo-4-chloro-3-indolylphosphate (BCIP)/ nitro-blue tetrazolium (NBT) (Roche) according to the manufacturer’s instructions.
-
Glutamine synthetase mRNA releases sRNA from its 3’UTR to regulate carbon/nitrogen metabolic balancebioRxiv - Microbiology 2022Quote: ... The antisense RNA probes corresponding to the 3’ s-end portion of glnA CDS were prepared by the DIG RNA Labeling Kit (Roche).
-
bioRxiv - Plant Biology 2022Quote: ... derived from SlARF2A and SlARF2B promoter was labeled with digoxigenin as per the manufacturer’s protocol using DIG Oligonucleotide 3′-End Labeling Kit (Roche Diagnostics). The same unlabeled DNA fragment was used as a competitor ...
-
bioRxiv - Plant Biology 2022Quote: ... derived from SlGLYI4 promoter was labelled with digoxigenin as per the manufacturer’s protocol using DIG Oligonucleotide 3′- End Labelling Kit (Roche Diagnostics). The same unlabelled DNA fragment was used as a competitor ...
-
bioRxiv - Microbiology 2022Quote: ... Hybridised probes were detected with anti-DIG antibodies and revealed with alkaline phosphatase-conjugated antibodies in presence of nitro blue tetrazolium (NBT) and 5-bromo-4-chloro-3-indolyl phosphate (BCIP, Roche).
-
bioRxiv - Bioengineering 2023Quote: ... SOS1•RAS complex was formed by incubating SOS1 and RAS at a stochiometric ratio of 1:3 overnight at 4° with 20 mM EDTA and alkaline phosphatase (Roche). The complex was then purified by gel filtration ...
-
bioRxiv - Cancer Biology 2023Quote: ... or MRTX849 for 3 hours prior to protein isolation with RIPA buffer containing 1x cOmpleted EDTA free protease inhibitor (Roche) and 1x phosSTOP (Roche) ...
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... Washes were followed by blocking in 10% heat-inactivated sheep serum for 1-3 hours and incubation in buffer containing sheep antidigoxigenin antibody (Roche) at 1:5000 dilution for 16-20 hours at 4oC ...
-
bioRxiv - Neuroscience 2023Quote: ... slides were incubated at 37oC in a staining solution containing nitro blue tetrazolium and 5-bromo-4-chloro-3-indolyl-phosphate (Roche) for 20-24 hours ...
-
Impact of light pollution at night on male reproductive success in Japanese medaka (Oryzias latipes)bioRxiv - Zoology 2023Quote: ... Each cDNA sample was measured in duplicate using 3 μL of 4x diluted cDNA per 10 μL reaction in a LightCycler96 Instrument (Roche). qPCR parameters were set to 10 minutes of preincubation at 95 °C ...
-
bioRxiv - Genomics 2024Quote: ... Nuclei were isolated by carefully transferring the extracted parasite mixture on top of a 0.25 M to 0.1 M sucrose gradient in cell lysis buffer (10 mM Tris pH 8, 3 mM MgCl2, 0.2% NP-40, 1x EDTA free Protease inhibitor (Roche, 04693132001); 15 mL 0.25 M Sucrose and 17.5 mL 0.1M Sucrose for 50 mL tubes ...
-
bioRxiv - Developmental Biology 2024Quote: ... dissected hindbrains were fixed in 4% PFA for 1 hour (and stored up to 3 months) and stained as previously described (Myat et al., 1996) using a digoxygenin-labelled riboprobe (Roche) against the target mRNA sequence (Table 3) ...
-
bioRxiv - Neuroscience 2024Quote: ... RNA was then subjected to further purification by precipitation with 3 volumes of KAPA Pure Beads according to manufacturer’s instructions (KAPA Biosystems). The assessment of RNA integrity number (RIN ...
-
bioRxiv - Developmental Biology 2024Quote: ... The signals were detected by 4-nitro-blue tetrazolium/5-bromo-4-chloro-3-indolyl phosphate (NBT/BCIP, Roche Diagnostics) in a humidified container for 12 h at 4°C ...
-
bioRxiv - Immunology 2024Quote: Single-cell suspensions of the tumors were obtained by incubating minced tissues with 3 mg/mL collagenase A (Roche, Germany) and 1 mg/mL DNase I (Roche ...
-
bioRxiv - Microbiology 2024Quote: ... and 2 µg) of HIV-1 NL4-3 full-length replication competent plasmid using X-tremeGENE HP (Roche Applied Science) transfection reagent as per manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: Single-cell suspensions of the tumors were obtained by incubating minced tissues with 3 mg/mL collagenase A (Roche, Germany) and 1 mg/mL DNase I (Roche ...
-
bioRxiv - Molecular Biology 2024Quote: ... uteri were harvested from pregnant mice at 4.5 days post coitus and washed with cold swelling buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 1X Protease Inhibitor Cocktail (PIC, Roche, 11836170001)) immediately after collection ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Hmef1a_R_val1_193: 5′-CCGTTAAGGAGCTGCGTCG-3′), and KOD SYBR qPCR Mix (Toyobo, Osaka, Japan) in a LightCycler 96 system (Roche, Basel, Switzerland). The qPCR reaction was made with 5 µl KOD SYBR (TOYOBO) ...
-
bioRxiv - Neuroscience 2024Quote: ... cells were harvested in PBS with protease inhibitors (1mM PMSF, Phosphatase Inhibitor Cocktail 3 [Sigma-Aldrich, P004] and Complete [Roche]) and centrifuged for 3 min at 500g at 4°C ...
-
bioRxiv - Biochemistry 2024Quote: ... Next the beads were washed 3 times with 800 µl of wash buffer (TBS + 0.1% Tween, EDTA-free Protease Inhibitor Cocktail (Roche, 04693132001)) ...
-
bioRxiv - Genomics 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Neuroscience 2024Quote: ... the slides were incubated for ∼72 hours at 37°C in staining solution containing nitro blue tetrazolium and 5- bromo-4-chloro-3-indolyl-phosphate (Roche). The slides were finally washed ...
-
bioRxiv - Biochemistry 2024Quote: ... Telomere ends were hybridized with Cy3-OO-(TTAGGG)3 in hybridization solution (70% formamide, 1 mg/ml blocking reagent (1109617601, Roche), and 10 mM Tris-HCl pH 7.2 ...
-
bioRxiv - Biophysics 2024Quote: ... 150 mM NaCl and 2 mM CaCl2 (“Na + Ca”) were incubated at 37° C with Proteinase K (3 μg/ml) (Roche). Aliquots are removed at different time intervals following addition of the protease (0 ...
-
bioRxiv - Bioengineering 2024Quote: ... lung tissue was minced and incubated in 3 mL of serum-free media containing 0.5 mg/mL DNase I (Roche, 10104159001) and 1 mg/mL collagenase type IV (Worthington ...
-
bioRxiv - Cancer Biology 2024Quote: ... concentrations was assessed using reduction in WST-1 (4-[3-(4-Iodophenyl)-2-(4-nitrophenyl)-2H-5-tetrazolio]- 1,3-benzene Disulfonate) to water-soluble formazan (Roche, France). Cells were seeded in 96-well plates at 2 × 104 cells/well and treated with the different NAM concentrations at 37°C ...
-
bioRxiv - Bioengineering 2024Quote: ... in PBS (PBST) and then blocked for 3 hours at RT in PBS with 5 wt% bovine serum albumin (BSA, Roche), 5% goat serum (Gibco) ...
-
bioRxiv - Neuroscience 2024Quote: ... Lung tissues were cut into small pieces and then digested in RPMI1640 containing 3 mg/mL of collagenase A (Roche) and 0.15 mg/mL of DNase I (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... the digestion with 3 mg/mL type I collagenase was performed in parallel to and compared with 3 mg/mL type I collagenase + 4 mg/mL type II Dispase (Roche), 250 μg/mL Liberase DL (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... RNA probes were generated via PCR amplification from 3 dpf cDNA fused to T7 promoter sequence and subsequently transcribed (DIG or FITC labeled) using T7 polymerase (Roche). Primer sequences can be found in supplemental table 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... at 4°C for 1 hour with end-over-end rotation and washed 3 times with 1X MAPK Lysis Buffer with 1X protease inhibitor (Complete, Roche). Worm lysates prepared from the above were then equally divided into tubes containing glutathione beads coated with respective proteins for 2 hours incubation at 4°C with end-over-end rotation ...
-
bioRxiv - Immunology 2021Quote: Total protein lysates from MDDC and cDC cultured for 1 h in the presence of media or individual or combined Poly I:C and 2′3′-di AM(PS) agonists were obtained using RIPA buffer containing 1% phosphatase and protease inhibitors (Roche Diagnostics). Subsequently ...
-
bioRxiv - Biophysics 2021Quote: ... transient transfection was performed with a total of 1 µg of plasmids (EGFRmCitrine, PTBmCherry and cCblBF P at ratio 4:3:4 by mass) using FUGENE6 (Roche Diagnostics) transfection reagent and Opti-MEM (Gibco - Thermo Fisher Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 mM imidazole), and 1X with SUMO wash buffer (3 mM imidazole, 10% glycerol, 1X PBS, 2 mM DTT) + PIC (Roche 05056489001). Recombinant MYC was eluted from the beads using SUMO elution buffer (250 mM imidazole ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2020Quote: ... for 3 mins at 80°C in hybridization solution (10 mM Tris-HCl pH 7.2, 70% formamide, 0.5% Roche 11096176001 blocking reagent). Hybridization was carried out for 2 hours at RT in the dark ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Cell Biology 2022Quote: ... The HEK 293T cells were mixed with 1 μg of mouse Ano9 cDNA (mAno9-pEGFP-N1) and 3 μl FuGene HD (Roche Diagnostics). The transfected cells were plated onto glass coverslips that were kept in a 35-mm round Petri dish ...
-
bioRxiv - Cancer Biology 2021Quote: ... and digested either for 1 hour at 37°C in a digestion mix of 3 mg/ml collagenase type A (Roche, 11088793001) and 25 μg/ml DNAse (Invitrogen ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Plant Biology 2020Quote: ... in a total volume of 6 μL containing 0.5 mM of each specific primer and 3 μl of SYBR Green I Master Mix (Roche Applied Science). The second derivative maximum method was used to determine Cp values and PCR efficiencies were determined using LinRegPCR software (http://LinRegPCR.nl) ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation to collect nuclei ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Cell Biology 2020Quote: ... and AdRb (5′-TCCTCGGCCG-3′) were ligated to the DpnI digested fragments in an overnight reaction at 16° C using T4 DNA ligase (Roche, 799009). After incubation the ligase was heat-inactivated at 65° C for 10 minutes ...