Labshake search
Citations for Roche :
501 - 538 of 538 citations for 3 3 Bromomethyl phenyl thiophene since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... Abutting primer pairs were designed that were specific to these genetic groups (Supplementary Table 3) to enable the recovery of full viral genomes using polymerase chain reaction (PCR) with HiFi HotStart DNA polymerase (Kapa Biosystems, USA) using cycling conditions per the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... ∼0.5×106cells were collected and wash 3 times with Wash buffer (20 mM HEPES-KOH, pH 7.5,150mM NaCl, 0.5mM Spermidine, and Roche Complete Protease Inhibitor EDTA-free). Cells were captured with BioMagPlus Concanavalin A (Polysciences ...
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were lysed in 50 µl of lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1× Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Microbiology 2023Quote: ... The membranes were developed in a NBT/BCIP solution (nitroblue tetrazolium chloride/5-bromo-4-chloro-3-indoxyl phosphate; Roche; Basel, CH) for up to 20 min at RT ...
-
bioRxiv - Biophysics 2023Quote: ... 150 mM NaCl, 10% sucrose, 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 3 mM ATP, 1 mM PMSF and Roche protease inhibitors). Native mouse regulatory light chain (RLC ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3 mM β-mercaptoethanol (BME) and 0.3 μg/ml DNase I supplemented with 600 μl of protease inhibitor cocktail (Roche, Basel, Switzerland) and 5 mg lysostaphin (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2024Quote: ∼ 200 embryos of 1dpf were placed in 1mL modified Ringer’s solution (116 mM NaCl, 3 mM KCl, 4 mM CaCl2, 5 mM HEPES; pH 7.5) containing Protease Inhibitor (Roche, Cat. No. 04693132001) and Phosstop (Roche ...
-
bioRxiv - Immunology 2024Quote: ... tissue sections (n = 2-3 per tissue type) underwent deparaffinization and heat-mediated antigen retrieval on the Ventana Discovery Ultra auto-stainer platform (Roche Diagnostics, Canada), following the below instructions ...
-
bioRxiv - Molecular Biology 2024Quote: ... Reaction volumes were increased to 50 ul and 3 μl was subsequently used for qPCR reactions with SYBR Green (Roche, cat# 04887352001). Forward primers were designed at the 5’ ending of tRNAs and the reverse primers were designed against the 3’adapter while specificity was created against the 3’ endings ...
-
bioRxiv - Neuroscience 2024Quote: ... specific digoxigenin (DIG)-labeled RNA probes and performed nitro blue tetrazolium (NBT)/ 5-bromo-4-chloro-3-indolyl-phosphate color-reaction (BCIP) after wash and incubation with anti-digoxigenin antibody (catalog. no. 11093274910; Roche; RRID: AB_514497) as previously reported (Zempo et al. ...
-
bioRxiv - Plant Biology 2024Quote: ... were finely chopped into pieces in cold nuclei extraction buffer (10 mM Tris–HCl pH 8.0, 10 mM MgCl2, 0.25 M sucrose, 3% triton X-100, 1% Roche protease inhibitor cocktail tablet). The resulting mixture was filtered through a 40 μm cell sieve into a collection tube and centrifuged at 1,000 g for 10 min at 4°C ...
-
bioRxiv - Plant Biology 2024Quote: ... The pellet was washed with the same cold nuclei extraction buffer (10 mM Tris–HCl pH 8.0, 10 mM MgCl2, 0.25 M sucrose, 3% triton X-100, 1% Roche protease inhibitor cocktail tablet) and then resuspended in nuclei purification buffer (20 mM MOPS pH 7.0 ...
-
bioRxiv - Molecular Biology 2024Quote: ... was annealed with Coccus-R primer (5′–ACG– TCA–GAA–TCG–CTG–C–3′) and analyzed using FastStart Essential DNA Green Master kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... Enrichment of 2 μg of an indexed library incubated with 3 μM of a pool of biotinylated oligonucleotides was performed using the SeqCap EZ Hybridization reagent kit (Roche/NimbleGen, Lot # 05634261001), following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 80 µl of dephosphorylation solution (8 μl 10x dephosphorylation buffer, 2 μl RNasin Plus, 67 μl ddH2O, and 3 μl alkaline phosphatase (Roche, catalog no. 10713023001)) was added to the beads ...
-
bioRxiv - Molecular Biology 2021Quote: ... For isolation of nuclei the cell pellet was resuspended in Buffer 1 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 20 min followed by a centrifugation step ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Neuroscience 2022Quote: ... 20 mg protein was loaded onto 8-10% SDS-PAGE gels for electrophoresis and subsequently transferred (90 V, 2-3 h) onto PVDF western blotting membranes (Roche, Cat. No. 3010040001) using the Criterion™ System BioRad ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were blocked with 3% BSA in HBSS buffer for 20 min and incubated with a primary antibody (rat anti-HA, Roche, RD11867423001, 1:100) overnight at 4 °C ...
-
bioRxiv - Cancer Biology 2024Quote: ... Strand-specific RNA libraries were prepared for sequencing (3 - 4 biological replicates/treatment) using a KAPA Stranded mRNA-Seq Kit (Kapa Biosystems, MA, USA). Poly-A mRNAs were purified from 100 ng of total RNA using poly-T-oligo-magnetic beads (Kapa Biosystems ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... initial denaturation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 15 sec, 60°C for 30 sec) (Roche LightCycler 96, Roche Diagnostics). For absolute quantification ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Bioengineering 2023Quote: ... followed by 10 minutes at 37°C in a 3% (w/v) collagenase A solution in PBS (Collagenase A, Roche Diagnostics GmbH, Germany, 10103586001). Cells were recovered by centrifugation for 5 minutes at 300g prior cell counting on Malassez cells after Trypan blue staining ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for target enrichment of ∼3 Mb of Lupinus angustifolius genomic material were produced using the Roche Sequencing Solutions’ ‘SeqCap EZ – HyperPlus’ kit (Roche Sequencing Solutions, Pleasanton, CA) with 200 ng/L of input DNA.
-
bioRxiv - Developmental Biology 2023Quote: ... Reverse transcription (RT) was performed from 2-3 µg of RNA with the Transcriptor First Strand cDNA Synthesis Kit (Roche Life Sciences, Basel, Switzerland) using random hexamer primers ...
-
bioRxiv - Microbiology 2021Quote: ... and then incubated overnight with primary antibody (monoclonal anti-FLAG, 1:1,000; Sigma-Aldrich, #F1804-1MG; or anti-GFP, 1:1000, Roche #11814460001 in 3% BSA/TBS-T) at 4°C ...
-
bioRxiv - Cell Biology 2022Quote: ... pellets were resuspended in 100 µL of lysis buffer (50 mM Tris pH 7.5, 1 mM EDTA, 3 mM DTT, 1X cOmplete protease inhibitor cocktail [SKU, 11836145001, Roche], 1.1 mM PMSF, and 1X Pepstatin A) and beaten on a bead-beater for 5 minutes at room temperature with 100 µL of acid-washed glass beads (cat ...
-
bioRxiv - Biochemistry 2024Quote: ... Cells were lysed using Lysis buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 3 mM TCEP and 1 tablet Roche Protease inhibitor per 10 mL of buffer). Lysate was clarified by centrifugation at 24,000 g for 40 mins at 4 °C ...