Labshake search
Citations for Roche :
4001 - 4050 of 5389 citations for QuantiChrom Magnesium Assay Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... total RNA was extracted from LOUCY cells using the High Pure RNA Isolation Kit (Roche Life Sciences, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... NPCs were washed by phosphate buffer saline (PBS) and stained by in situ Cell Death Detection Kit (Roche, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... The complementary DNA (cDNA) was synthesized using a transcriptor high fidelity cDNA synthesis kit (Roche Applied Science, Penzberg, Germany). Each prepared sample used 20 µL of the SYBR green qPCR reaction kit (Roche Applied Science) ...
-
bioRxiv - Microbiology 2020Quote: ... 1 μg poly[d(I-C)] and 0.1 μg poly-Lysine (based on DIG Gel Shift Kit, 2nd Generation, Roche) for 15 min at RT ...
-
bioRxiv - Microbiology 2020Quote: ... pooled and quantified by qPCR with the KAPA Library quantification kit for Illumina platforms (Kapa Biosystems, Wilmington MA, USA) on a StepOnePlus qPCR system (Thermo-Fisher Scientific) ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was extracted from the culture supernatant after each passage using a High Pure Viral RNA kit (Roche Diagnostics). For deep sequencing of the S1/S2 cleavage site of the viral S gene ...
-
bioRxiv - Neuroscience 2021Quote: ... The library amplification step included 6-7 PCR cycles and was performed using the KAPA Library Amplification kit (Roche). The final Hi-C library was purified using SPRIselect beads and the quality and size of the library (approximately 500 bp ...
-
bioRxiv - Genetics 2021Quote: BAM files from previously published multi-region WES data (generated using the SeqCapEx Exome Enrichment Kit v3.0 (Nimblegen/Roche)) from nine sporadic fresh-frozen adenomas were available (Supplementary Table 2).11 Somatic variants were re-called using Mutect2 as above.
-
bioRxiv - Microbiology 2021Quote: ... The 16S rRNA V3–V4 amplicon was amplified using a KAPA HiFi HotStart ReadyMix PCR Kit (KAPA BioSystems, USA). the amplicon PCR forward primer (5’-CCTACGGGNGGCWGCAG-3’ ...
-
bioRxiv - Cell Biology 2020Quote: ... 4 were purified according to the instructions of the manufacturer using the High Pure PCR Template Preparation Kit (Roche) followed by RNAse A digest and a final purification with the High Pure PCR Product Purification Kit (Roche).
-
bioRxiv - Plant Biology 2021Quote: ... Library preparation and sequencing were performed by the iGenSeq genotyping and sequencing core facility (ICM Institute - Hôpital Pitié-Salpêtrière AP-HP, Paris, France) using KAPA HyperPrep Kits (Roche, Basel, Switzerland) and the NovaSeq 6000 sequencer (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... hygromycin B phosphotranferase (HYG) or blastacidin S deamidase gene (BSD) generated using the PCR DIG Probe Synthesis Kit (Roche). The blot was developed according to the manufacturer’s instructions.
-
bioRxiv - Molecular Biology 2020Quote: ... The qPCR was performed using KAPA SYBR® FAST qPCR Kit Master Mix (2X) Universal (Kapa Biosystems; Massachusetts, USA). Protein expression at day 10 post transfection was analyzed by immunocytochemistry using the following antibodies and dilutions ...
-
bioRxiv - Developmental Biology 2020Quote: ... TUNEL staining was performed according to respective manufacturer protocol using Terminal Deoxynucleotidyl Transferase kits (Invitrogen #10533065 or Roche #03333574001), dig-UTP (Roche ...
-
bioRxiv - Genomics 2020Quote: A screenshot showing read visualization by IGV of the region were the Alu insertion occurred in the positive control sample (BRCA1) when using the SeqCap EZ Exome v3.0 kit from Roche for exome capture is presented in Figure 2 ...
-
bioRxiv - Cancer Biology 2020Quote: ... 100-500 ng of DNA were used to prepare libraries using the KAPA Hyper Prep Kit (Kapa Biosystems KK8504) with 8 cycles of PCR ...
-
bioRxiv - Biophysics 2021Quote: ... The troponin T detection kit (Elecsys® Troponin T Gen 5 STAT) and troponin T were purchased from Roche. 1X phosphate-buffered saline (PBS ...
-
An optimized ChIP-Seq framework for profiling of histone modifications in Chromochloris zofingiensisbioRxiv - Genomics 2021Quote: RNA was converted into cDNA and made into sequence ready libraries with the KAPA RNA-Seq Kit (Kapa Biosystems). RNA-Seq libraries were sequenced with 150 bp single-end reads on a HiSeq 2500 ...
-
bioRxiv - Cell Biology 2020Quote: RACE-cDNA was synthesized according to the manufacturer’s protocol for 5’/3’ RACE Kit 2nd generation (Roche; Cat.No. 03353621001). The 2648-bp cDNA was cloned into the NheI-XhoI site in pcDNA 3.1 plasmid to obtain pcDNA3.1-DR5-AS and was verified by sequencing ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR analyses confirmed mouse genotypes with DNA isolated from ear biopsies using the KAPA Mouse Genotyping Kits (Kapa Biosystems). All PCR primers are listed in Supplementary Table 1.
-
bioRxiv - Developmental Biology 2022Quote: ... The library was enriched using 14 PCR cycles and quantified with Kapa NGS library quantification kit (Kapa Biosystems, KK4824) before pooling at a concentration of 20nM ...
-
bioRxiv - Cancer Biology 2022Quote: ... Post-capture amplification was performed using the KAPA HiFi Hot Start PCR ReadyMix Kit (KAPA Biosystems, Catalogue no. KK2601). Post-capture amplified libraries were quality controlled and quantified using a Tapestation 2200 with the High Sensitivity reagents.
-
bioRxiv - Molecular Biology 2022Quote: Southern blot analysis was performed using the DIG High Prime DNA Labeling and Detection Starter Kit II (Roche 11585614910) and the DIG Wash and Block Buffer Set (Roche 11585762001) ...
-
Activation of the Integrated Stress Response overcomes multidrug resistance in FBXW7-deficient cellsbioRxiv - Cancer Biology 2022Quote: ... The U6-sgRNA cassette was then amplified by PCR using the KAPA HIFI Hot Start PCR kit (Roche, KK2502) and different tagged primers required for the subsequent Illumina sequencing ...
-
bioRxiv - Microbiology 2022Quote: ... Library quality control and quantification were performed using a KAPA Library Quantification Kit for Illumina Platforms (Kapa Biosystems, KK4873) and the 2100 Bioanalyzer equipped with a High Sensitivity DNA kit (Agilent ...
-
bioRxiv - Genetics 2022Quote: ... Library preparation was performed with 1ug of sheared DNA using Kapa Biosystems Hyper Prep Kit (Roche, product number KK8504) dual index adapters (KAPA ...
-
bioRxiv - Cancer Biology 2022Quote: 300 ng of total RNA was used for library preparation using the KAPA RNA HyperPrep kit with RiboErase (Roche), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: Pax6a digoxigenin (DIG) antisense RNA probes were generated from linearised plasmids using an RNA labelling and detection kit (Roche) (Scholpp and Brand ...
-
bioRxiv - Systems Biology 2022Quote: ... libraries for polyA+ RNA were prepared using KAPA Stranded RNA-Seq Kit for Illumina Platforms (KAPA Biosystems, Wilmington, MA) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... and RNA sequencing libraries were prepared using 400 ng of total RNA using the Kapa mRNA Hyperprep kit (Roche) at 1/3rd reaction volume using 14 cycles of PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... Sections were also stained for β-galactosidase (β-gal) activity with the use of a staining kit (11828673001, Roche). Apoptotic cells were detected by TUNEL analysis with digoxigenin-labelled dUTP (S7105 ...
-
bioRxiv - Plant Biology 2021Quote: ... The qPCR was run using KAPA SYBR® FAST qPCR Kit Master Mix on LightCycler® 96 instrument (Roche) as described previously described (Han et al. ...
-
bioRxiv - Microbiology 2021Quote: ... The RNA-seq library was prepared from viral RNA extracts using the KAPA RNA HyperPrep Kit (Roche, Penzberg, Germany) and KAPA DI adaptors according to the manufacturers’ instructions ...
-
bioRxiv - Developmental Biology 2020Quote: ... DIG-labeled probes where generated using T7/SP6 transcriptions start sites and the digoxigenin RNA Labeling Mix kit (Roche) after manufactures instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... The TUNEL reaction was performed in a humid chamber for 2.5 h at 37 °C with the in Situ Cell Death Detection Kit (Roche) using 100 μL of reaction mixture per slide ...
-
bioRxiv - Cell Biology 2020Quote: ... and the concentration of indexed libraries was quantified following the protocol of the KAPA library quantification kit (Kapa Biosystems). For each donor libraries from all tissues were combined prior to sequencing and sequenced on the Illumina Hiseq 4000 system in 2 lanes.
-
bioRxiv - Neuroscience 2021Quote: ... Expressed sequence tags (ChESTs; SourceBioScience) were used to generate in situ probes using a DIG RNA labeling kit (Roche). In situ hybridization was performed as described (Mauti et al. ...
-
bioRxiv - Developmental Biology 2022Quote: ... and PCR products were quantified fluorometrically using the KAPA SYBR FAST qPCR Master Mix (2X) Kit (KR0389, KAPA Biosystems).
-
bioRxiv - Genetics 2022Quote: ... Total Ty1-copia sequences labeled with DIG were prepared as probes using the PCR-DIG Probe Synthesis Kit (Roche). ImageJ and Calculator software (http://cels.uri.edu/gsc/cndna.html ...
-
bioRxiv - Cell Biology 2022Quote: ... sequencing libraries were prepared by using a modified version of the KAPA HyperPrep library kit (KAPA Biosystems, Willmington, MA) and sequenced by a NovaSeq instrument ...
-
bioRxiv - Pathology 2022Quote: The supernatant from cultured NRVMs was collected to determine the content of LDH via cytotoxicity detection kit (Roche, USA), following the manufacturer’s instructions.
-
bioRxiv - Plant Biology 2022Quote: ... The prepared libraries were then quantified by qPCR using the Kapa SYBR Fast Illumina Library Quantification Kit (Kapa Biosystems) and run on a Roche LightCycler 480 real-time PCR instrument ...
-
bioRxiv - Bioengineering 2022Quote: ... The libraries were pooled to 10 nM and diluted for qPCR using the KAPA Library Quantification Kit (Kapa Biosystems). Subsequently the pooled libraries were normalized to 4 nM based on qPCR values ...
-
bioRxiv - Developmental Biology 2019Quote: Digoxigenin (DIG)-labelled probes for in situ hybridization was synthesized by PCR using DIG RNA labelling kit (Roche #11175025910). The probes for Ssadh and CG33791 (αKDH ...
-
bioRxiv - Genomics 2019Quote: ... Libraries were prepared from total RNA following rRNA depletion with KAPA RNA HyperPrep Kit RiboErase according to manufacturer’s instructions (Roche). Illumina NovaSeq 50 bp paired-end sequencing was performed to obtain 50 million raw reads per library.
-
bioRxiv - Microbiology 2019Quote: ... RNA was manually extracted from fluid samples (CSF or blood serum) using the High Pure Viral RNA Kit (Roche). RNA was then subjected to reverse transcription and quantitative PCR using primers and a fluorescently conjugated probe on an Applied Biosystems 7900 instrument.
-
bioRxiv - Genetics 2019Quote: ... Gene expression was detected by RT-PCR using gene specific primers, (FW:AAAGCAGAACTGTTTGGCGG, RV:TTGGGACTGATGGACAAGGC) and a SYBR green nucleic acid-labeling SYBR FAST kit (Kapa Biosystems) in a Lightcycler 480 (Roche) ...
-
bioRxiv - Plant Biology 2020Quote: ... qRT-PCR reaction was prepared using a LightCycler® 480 SYBR Green I Master kit (Roche Diagnostics, Mannheim, Germany) and the PCR was performed with a LightCycler® 480 Instrument II (384-well ...
-
bioRxiv - Molecular Biology 2019Quote: ... Diluted extracts were amplified in 12 parallel reactions using the Transcriptor One-step RT-PCR kit (Roche, Basel, Switzerland) for reverse-transcription and first-round PCR ...
-
bioRxiv - Cancer Biology 2019Quote: Quantification of libraries was performed by quantitative polymerase chain reaction (qPCR) using the KAPA Library Quantification kit (KAPA Biosystems). Library fragment size was determined by the Agilent 2100 Bioanalyzer (Agilent Technologies) ...