Labshake search
Citations for Roche :
351 - 400 of 8498 citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2023Quote: ... HEK293T cells were lysed in LUMIER lysis buffer (50 mM Hepes-KOH pH 7.9, 150 mM NaCl, 2 mM EDTA, 0.5% Triton X-100, 5% glycerol and Roche cOmplete™ Mini protease Inhibitor Cocktail ...
-
bioRxiv - Physiology 2024Quote: ... 5 mM EDTA, 2% Triton-X-100, 0.2 mM HDSF, pH 7.4, and protease inhibitor cocktail from Roche). Following sonication on ice ...
-
bioRxiv - Neuroscience 2023Quote: ... 5 mg.kg-1 midazolam (Dormicum, Roche), and 0.05 mg.kg-1 fentanyl (Fentanyl ...
-
bioRxiv - Cell Biology 2022Quote: ... Cells at 70% confluence were harvested by trypsinization (after 3-4 hours treatment with 100 ng/mL colcemid [Roche #10295892001] for metaphase spreads), washed with PBS ...
-
bioRxiv - Cancer Biology 2024Quote: ... Strand-specific RNA libraries were prepared for sequencing (3 - 4 biological replicates/treatment) using a KAPA Stranded mRNA-Seq Kit (Kapa Biosystems, MA, USA). Poly-A mRNAs were purified from 100 ng of total RNA using poly-T-oligo-magnetic beads (Kapa Biosystems ...
-
bioRxiv - Genetics 2021Quote: ... The T7 promoter was added to the 5’ and 3’ ends to synthesize the sense and anti-sense probes using the DIG RNA Labeling Kit (Roche, Cat# 11175025910). In situ hybridization was performed as previously described [65,66] with minor modifications ...
-
bioRxiv - Molecular Biology 2024Quote: ... was annealed with Coccus-R primer (5′–ACG– TCA–GAA–TCG–CTG–C–3′) and analyzed using FastStart Essential DNA Green Master kit (Roche, Basel, Switzerland) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2020Quote: ... glycerol 25%, KCl 20 mM, EDTA 2 mM, MgCl2 2.5 mM, Sucrose 250 mM, DTT 5 mM, protease inhibitor Roche™, 1 tablet/ 50 mL) at a ratio of 1:3 (w/v) ...
-
bioRxiv - Cancer Biology 2020Quote: ... 20 mM imidazole), and 1X with SUMO wash buffer (3 mM imidazole, 10% glycerol, 1X PBS, 2 mM DTT) + PIC (Roche 05056489001). Recombinant MYC was eluted from the beads using SUMO elution buffer (250 mM imidazole ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation to collect nuclei ...
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Immunology 2023Quote: ... coated with 2.5ug/mL aCD3 and re-stimulated for an additional 3 days in complete IMDM-10 supplemented with 50U/mL IL-2 (Roche 11011456001). For Th17 polarizations ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CBD patients were gently homogenized at 4 °C in 5 mL of TBS buffer containing one tablet of cOmplete™ mini EDTA-free protease inhibitor cocktail (Roche) at a concentration of 20% w/vol using a Dounce homogenizer ...
-
bioRxiv - Biochemistry 2022Quote: ... were homogenized in 7x w/v homogenization buffer (320 mM sucrose, 4 mM HEPES–NaOH, 2 mM EDTA, and Complete protease inhibitor mix (Roche), pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide using an additional amount of 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide in 530 μL medium with 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % sodium deoxycholate and 1 % Triton X-100 as well as protease inhibitors (10 mg / ml leupeptin, pepstatin A, 4-(2-aminoethyl) benzensulfonyl-fluorid and aprotinin) and phosphatase inhibitors (PhosSTOP−, Roche). Total cell lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...
-
bioRxiv - Neuroscience 2023Quote: ... diluted in PBS for 2 hours at room temperature after which they were counterstained with 300 nM 4’,6’-diamino-2-phenylindole (DAPI; 10236276001, Roche) for 5 minutes ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were then blocked in blocking solution (maleic acid buffer containing 2% Boehringher-Mannheim blocking reagent) and incubated overnight at 4°C in blocking solution containing anti digoxigenin antibody (Roche) diluted at 1:2000 ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was diluted to 2 ng/µL and 4 µL were added to 10 µL 2x FastStart Universal SYBR Green PCR Master (Roche). Each sample was run in triplicate using iTaq Universal SYBR Green Supermix (BioRad ...
-
bioRxiv - Genetics 2023Quote: ... for 30 min at room temperature and incubated for 2 h at room temperature or overnight at 4°C with primary antibodies against GFP (Roche), androgen receptor (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Probes were synthesized at 37°C for 2–4 hrs in digoxigenin-synthesis reaction mixture with T7 RNA polymerase (Roche). After synthesis ...
-
bioRxiv - Cell Biology 2024Quote: ... Cells were washed three times with 1X PBS before nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, Roche) for 10 min at RT ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500 μL of whole cell extract (WCE) was incubated overnight at 4°C with 2 μg anti-c-myc antibodies (mouse monoclonal, clone 9E10, Roche) for immunoprecipitation of myc-tagged proteins ...
-
bioRxiv - Immunology 2024Quote: ... were coated with 2 µg/ml capture antibodies in PBS at 4°C overnight and blocked with blocking buffer containing 2% BSA fraction V (Roche) in PBS-T (0.05% Tween-20 (Daejung ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were lysed in Buffer A (2 M NaCl, 20 mM HEPES pH 7.5, 20 mM Imidazole, 5 mM βME, protease inhibitor (Roche)) by sonication ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG-labelled cDNA probe was incubated at 95 °C for 10 min and immediately placed in the ice for 5 min before adding to the hybridization buffer (5x SSC, 50 % formamide, 0.02 % SDS, 2 % blocking agent (Roche), DEPC-treated water) ...
-
bioRxiv - Neuroscience 2023Quote: ... cells and sections were processed for BrdU immunodetection following the manufacturer’s recommendations (5-Bromo-2′-deoxy- uridine Labelling and Detection Kit I, Roche). The slides were mounted for fluorescent microscopy in ProLong® Diamond Antifade Mountant with DAPI (Life Technologies).
-
bioRxiv - Physiology 2024Quote: Fibroblast proliferation was assessed using a 5-bromo-2’-deoxyuridine (BrdU) incorporation assay (colorimetric) from Roche (Indianapolis, IN, USA) for 48 h following the manufacturer’s instructions.
-
Conserved Cis-Acting Range Extender Element Mediates Extreme Long-Range Enhancer Activity in MammalsbioRxiv - Genomics 2024Quote: ... embryos were with PBT (x3, 15mins) and incubated in prehybridization buffer (50% deionized formamide, 5× SSC, pH 4.5, 2% Roche Blocking Reagent ...
-
bioRxiv - Cell Biology 2022Quote: ... 0.1 mM CaCl2, 5 mM EGTA, 50 mM sucrose, 0.1% Triton X-100, 1/2 tablet of cOmplete inhibitor [Roche], and 2.5 U/mL Benzonase [Novagen]), lysed by sonication ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Cell Biology 2021Quote: ... in 5 mg ml−1 dispase (Roche) and 0.1 mg ml−1 DNase I (Sigma ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Samples were washed through regular hybridization buffer/SSC series and incubated in 1:1000 pre-absorbed anti-DIG-AP fab fragment (Roche)/5% sheep serum/1% blocking reagent (Roche)/1% DMSO/TNT at 4°C overnight ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Cancer Biology 2020Quote: Cells were lysed using 2-5 times the volume of RIPA lysis buffer supplemented with 1x protease inhibitor cocktail (Roche), PMSF (1 mM ...
-
bioRxiv - Microbiology 2021Quote: ... the remaining dermis was washed in Ca2+ and Mg2+ free PBS 5 times and incubated in a digestion buffer containing 2 mg/ml collagenase A (Roche), 100 µg/ml of DNase I (Sigma ...
-
bioRxiv - Cancer Biology 2021Quote: Total RNA was extracted from 58 macro-dissected regions of slides G1-5 in samples UH1-UH16 and 30 regions of slides F1-5 in samples UH17-UH23 and UH25-UH27 (Supplementary Table 2) using the High Pure FFPE RNA isolation kit (Roche). For UH4 ...
-
bioRxiv - Genomics 2020Quote: ... was synthesised commercially and then labelled with digoxigenin-11-2’-deoxyuridine-5’-triphosphate (DIG-11-dUTP) using terminal transferase (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2021Quote: ... water was exchanged for 100 µL water with 5 µM L-012 (WAKO chemicals) and 2 µg/mL horseradish peroxidase (Type II, Roche). After the leaf discs were treated with 1 µM 3-OH-C10:0 (stock in MeOH ...
-
bioRxiv - Biochemistry 2023Quote: ... cell pellets were resuspended in HR buffer (50 mM Tris-HCl, 5 mM MgCl2, 250 mM sucrose, 2 mM TCEP and protease inhibitor t (Roche), pH 7.4) ...
-
bioRxiv - Cancer Biology 2023Quote: ... glands were minced into paste and incubated in 5 mL DME/F-12 medium (HyClone, #SH30023.1) with 2 mg/mL collagenase A (Roche #10103578001), 100 units/mL hyaluronidase (Sigma-Aldrich ...
-
bioRxiv - Molecular Biology 2022Quote: ... The loci of interest were first amplified with 15 cycles of PCR from 2 μL (∼100 ng) of genomic DNA eluate using a 5 μL Kapa HiFi HotStart polymerase reaction (Roche). The first PCR was then diluted with 25 μL of DNAse-free water ...