Labshake search
Citations for Roche :
151 - 200 of 8498 citations for Tert Butyldimethyl 3 4 4 5 5 Tetramethyl 1 3 2 Dioxaborolan 2 Yl Phenoxy Silane since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2024Quote: ... and 5 mM MgCl2) containing 4-nitro blue tetrazolium chloride (NBT, Roche), 5-bromo-4-chloro-3-indolyl-phosphate (BCIP ...
-
bioRxiv - Molecular Biology 2022Quote: ... the cobas p 612 pre-analytical unit (scenario 3 and 4; Roche Diagnostics International), and the cobas p 501 post-analytical unit (scenario 4a ...
-
bioRxiv - Cell Biology 2022Quote: ... all sections were stained with DAPI (4′,6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000) to visualize cell nuclei within the aortic tissue ...
-
bioRxiv - Neuroscience 2024Quote: ... Cell nuclei were labelled with 4’,6-Deamidine-2’-phenylindole dihydrochloride (DAPI, 1:1000; Roche, #10236276001) for 20 min at room temperature ...
-
bioRxiv - Synthetic Biology 2020Quote: ... and 2) 5 10^6 copies of bacteriophage MS2 RNA (Roche) were spiked in per isolation ...
-
bioRxiv - Molecular Biology 2022Quote: ... 20 μl of 10X 5-Bromo-2’-deoxyuridine (BrdU) (Roche, Germany) per well was added ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were counterstained with 4’,6-Diamidine-2’-phenylindole-dihydrochloride (DAPI; Roche).
-
bioRxiv - Molecular Biology 2023Quote: ... nuclei were stained using 4’,6-diamidino-2-phenylindole (DAPI, Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2021Quote: ... DNA was prepared using Qiagen Large-Construct Kit and labelled with tetramethyl-rhodamine-5-dUTP (Roche Applied Sciences) by using the Nick Translation Mix (Roche Applied Sciences ...
-
bioRxiv - Genomics 2021Quote: ... DNA was prepared using Qiagen Large-Construct Kit and labelled with tetramethyl-rhodamine-5-dUTP (Roche Applied Sciences) by using the Nick Translation Mix (Roche Applied Sciences ...
-
bioRxiv - Neuroscience 2024Quote: ... and BCIP (5-bromo-4-chloro-30-indoly phosphate p-toluidine salt, Roche). After development ...
-
bioRxiv - Microbiology 2023Quote: Transcriptional start sites (TSS) of rokL6 and sco1448 were determined by 5’ RACE using a 5’/3’ RACE Kit 2nd generation (Roche, California, US). Total RNA (2 μg ...
-
bioRxiv - Molecular Biology 2024Quote: ... all tissue sections were stained with DAPI (4’, 6-Diamidine-2’-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). Images were taken with a confocal microscope from Zeiss (LSM 880 Airyscan).
-
bioRxiv - Cell Biology 2023Quote: ... all tissue sections were stained with DAPI (4′, 6-Diamidine-2′-phenylindole dihydrochloride, #10236276001, Roche, 1:3000). For image generation an Axio Observer ...
-
bioRxiv - Bioengineering 2023Quote: ... SOS1•RAS complex was formed by incubating SOS1 and RAS at a stochiometric ratio of 1:3 overnight at 4° with 20 mM EDTA and alkaline phosphatase (Roche). The complex was then purified by gel filtration ...
-
bioRxiv - Neuroscience 2020Quote: ... Peels were cut in 2-5 mm2 pieces and placed in 5 ml digestion solution (0.75 mg/ml Liberase TH Research grade (Roche), 0.1 mg/ml DNAseI (Sigma-Aldrich ...
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Neuroscience 2020Quote: ... Then embryos were incubated for 2 hours in 5% Blocking Reagent (Roche) in MAB (150 mM maleic acid ...
-
bioRxiv - Genomics 2023Quote: ... 5 mM 2-mercaptoethanol and cOmplete Protease Inhibitor Cocktail (Roche, no. 11697498001). The cell suspension was subjected to sonication (Qsonica ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Genetics 2020Quote: ... 721-bp tandem and 1600-bp tandem repeats were selected and PCR labelled with tetramethyl-rhodamin-5-dUTP (Roche) (Ishii et al ...
-
bioRxiv - Molecular Biology 2023Quote: ... were stained overnight with 4′,6-diamidino-2-phenylindole (DAPI, Roche, Basel, Switzerland) at a final concentration of 5 µg ml-1 ...
-
bioRxiv - Immunology 2024Quote: ... The cells were stained with 4′,6-diamidine-2′-phenylindole (DAPI; Roche, #10236276001). Images were taken with a Zeiss LSM 900 microscope (Carl Zeiss ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Genetics 2021Quote: ... followed by addition of 5 µl of 4 µg/mL DNase-free RNase (Roche). Samples were loaded onto 96-well Qiacube-HT® columns and DNA was purified using a Blood & Tissue kit (Qiagen) ...
-
bioRxiv - Developmental Biology 2021Quote: ... 1 µM tetramethyl-rhodamine-dUTP (TMR-dUTP: Roche, 11534378910 ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Animal Behavior and Cognition 2021Quote: ... ∼200-300 embryos were dechorionated 3-6 hours after injection by 5 min incubation in 1 mg/ml pronase (Roche) in E3 medium in a 2% agarose-coated petri dish and washed with excess amount of fresh E3 ...
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Neuroscience 2021Quote: ... we labeled cell nuclei with DAPI (4’,6-diamidino-2-phenylindole; 1:10.000, Roche Diagnostics GmbH, Mannheim, Germany).
-
bioRxiv - Molecular Biology 2024Quote: ... 500 mM NaCl, 4 mM MgCl2, 2 mM DTT, 1% SDS, 0.5% sodium deoxycholate, 0.5% Igepal, supplemented with Roche Complete Protease Inhibitor cocktail (1 tablet/50 mL)) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% milk and probed overnight at 4°C with 1:2,500 rat anti-HA mAb 3F10 (Roche). They were then incubated for an hour at RT with 1:5,000 anti-rat horseradish peroxidase conjugated antibody (GE Healthcare) ...
-
bioRxiv - Immunology 2022Quote: ... Tissue pieces then were transferred to a 50-mL conical tube containing 5 ml of digestion medium #2 (RPMI without phenol red containing 5% of FCS, 25 µg/ml of Liberase (Roche), and 200 µg/ml of DNase I (Sigma)) ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2023Quote: ... ‘reverse’ 5’-GGGTACTTGATTTCATAGACTTTA-3’) were used in a qRT-PCR on a LightCycler 480 II (Roche). The data were analysed with LightCycler® 96 SW 1.1 (Roche) ...
-
bioRxiv - Cancer Biology 2024Quote: ... 3 μl of 10% SDS and 5 μl of 10 mg/ml Proteinase K (Roche, #31158) were added and incubated at 50 °C for 1 h ...
-
bioRxiv - Physiology 2024Quote: ... fixed with 4% PFA for 15 min and stained with 4′,6-diamidino-2-phenylindole (DAPI) (0.1 µg/mL; Roche, cat no. 10236276001) for 10 min at RT ...
-
bioRxiv - Biochemistry 2022Quote: ... 5% glycerol and 2 mM Dithiothreitol (DTT)) supplemented with protease inhibitor cocktail (Roche) and lysed by sonication on ice ...
-
bioRxiv - Cell Biology 2022Quote: ... the 5-Bromo-2’-deoxy-uridine Labelling and Detection Kit II (Roche, UK) was used per manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... 2 mM β-mercapto-ethanol) supplemented with 5 μg/ml DNase I (Roche) and lysed using a homogenizer (Avestin Emulsiflex C5 ...