Labshake search
Citations for Roche :
351 - 400 of 415 citations for Recombinant Human CEACAM1 His tagged since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2020Quote: ... The RNA probes complementary to human METTL7B cDNA (NM_152637.2) were labeled with digoxigenin-UTP (Roche). After acetylation ...
-
bioRxiv - Genetics 2022Quote: ... Probes were then mixed with 20μg of COT Human DNA (Roche, 11 581 074 001) and 79μg of Salmon sperm DNA (Invitrogen ...
-
bioRxiv - Biophysics 2021Quote: ... Human periocular skin was digested in 2.4 U/ml dispase type II (Roche, Basel, Switzerland) at 4 °C for 12 hours ...
-
bioRxiv - Cell Biology 2022Quote: ... 30 ml of additional human dynein lysis buffer supplemented with cOmplete protease inhibitor cocktail (Roche) was added to the frozen cell pellet ...
-
bioRxiv - Microbiology 2020Quote: ... according to the manufacturer’s instructions and ethanol precipitated with human Cot-1 DNA (Roche, Germany) and herring sperm DNA (Sigma Aldrich) ...
-
bioRxiv - Immunology 2020Quote: Data on miRNA expression were obtained from the FANTOM5 dataset (https://fantom.gsc.riken.jp/5/suppl/De_Rie_et_al_2017/vis_viewer/#/human) and from (18) (Cohort Roche, GEO accession: GSE28492). The FANTOM5 dataset was downloaded and analyzed using Qlucore Omics Explorer software ...
-
bioRxiv - Cancer Biology 2023Quote: ... and retrotranscribed cDNA quantified using the Universal Human Probe Roche library (Roche-Diagnostics, Barcelona, Spain). Assays were made in triplicate and normalized to TBP expression (ΔΔCT method) ...
-
bioRxiv - Cell Biology 2024Quote: Human islets (20-30K IEQ) were dissociated the day after isolation with collagenase P (Roche) digestion for 15 minutes at 37 ℃ ...
-
bioRxiv - Cancer Biology 2021Quote: ... 50 ng of labeled probe was mixed with 10 μg of human Cot-1 DNA (Roche) and 10 μg each of salmon sperm DNA and E ...
-
bioRxiv - Neuroscience 2022Quote: ... Primers were designed using the Universal Probe Library (UPL) Probefinder software for human (Roche, version 2.53) or using previously published sequences and adjusted to be intron-spanning ...
-
bioRxiv - Cancer Biology 2024Quote: ... were transfected into the human 293FT cell line using X-tremeGENE 9 DNA transfection reagent (Roche). After 48 hours ...
-
bioRxiv - Cancer Biology 2023Quote: ... Primary antibodies used for the immunostaining include human ERα rabbit monoclonal antibody (Roche Diagnostics, 790-4325), human PR rabbit monoclonal antibody (Roche Diagnostics ...
-
bioRxiv - Cancer Biology 2023Quote: ... Regions to sequence were selected with the SeqCap EZ Human Exome Library v3.0 (Roche Applied Science) according to the manufacturer’s instructions and underwent 2 × 151 base-pair sequencing on Hiseq 4000 (Illumina ...
-
bioRxiv - Cell Biology 2024Quote: ... human skin was cut into thin pieces and incubated overnight at 4°C with dispase (Roche) at 2.4 U/ml ...
-
bioRxiv - Cancer Biology 2024Quote: ... 10 µm paraffin embedded human tissue slides were stained with OptiView DAB IHC Detection kit (Roche). The slides were permeabilized with 0.1 % Tween20 in PBS ...
-
bioRxiv - Neuroscience 2021Quote: ... Vector DNA was transiently transfected into human embryonic kidney (HEK) cells using Fugene-6 (Roche Molecular Biochemicals) transfection reagent ...
-
bioRxiv - Immunology 2021Quote: ... Antibody protein treatments (anti-SARS-CoV-2 mAbs or human IgG1 isotype control Trastuzumab/Herceptin® (Roche)) were initiated 24 hours post infection by intraperitoneal injection ...
-
bioRxiv - Immunology 2021Quote: Total RNA was retrotranscribed and cDNA was quantified using the Universal Human Probe Roche library (Roche Diagnostics). Quantitative real-time PCR (qRT-PCR ...
-
bioRxiv - Immunology 2024Quote: Mice or Human CD4 T cells were lysed using RIPA buffer supplemented with protease inhibitor cocktail (Roche) and phosphatase inhibitors (Pierce) ...
-
bioRxiv - Cancer Biology 2023Quote: ... and goat anti-human AF647 (Stratech 109-606-088- JIR)) DNA was then stained with DAPI (Roche) and coverslips mounted with Vectashield (Vector Laboratories - Vector H-1000).
-
bioRxiv - Cell Biology 2021Quote: Human stem cells and neurons lysed with RIPA lysis buffer supplemented with 5mM EDTA and protease inhibitor (Roche), for 5 minutes at room temperature and 10 minutes on ice ...
-
bioRxiv - Immunology 2021Quote: ... freshly resected human samples were cut into small fragments and digested with 0.1 mg/ml Liberase TL (Roche) and 0.1 mg/ml DNase (Roche ...
-
bioRxiv - Developmental Biology 2021Quote: On day 0 (start of differentiation) human pluripotent stem cells were treated with 1mg/ml Collagenase B (Roche) for 1 hour ...
-
bioRxiv - Neuroscience 2020Quote: ... human vimentin immunohistochemical staining of the paraffin sections was performed by using the Ventana Discovery XT instrument (Roche) with Ventana DAB Map detection Kit (760-124 ...
-
bioRxiv - Immunology 2024Quote: ... Fresh resected human PDAC samples were kept in PBS containing protease inhibitor (cOmplete Tablets EDTA-free, EASYpack, Roche) on ice ...
-
bioRxiv - Cancer Biology 2024Quote: ... or TaqMan assays (human ETC genes) on a real-time fluorescence qPCR instrument (LightCycler 480II, Roche Life Science). The expression of relative mRNA was normalized to that of the housekeeping gene 18S ...
-
bioRxiv - Immunology 2021Quote: ... Culture media was supplemented with 500 U/mL human IL-2 (Tecin from Roche, kindly provided by the NIH) starting on culture day 2 ...
-
bioRxiv - Microbiology 2021Quote: ... and human acute promyelocytic leukemia cell line NB4 (ATCC) were washed once with the digestion buffer for neuraminidase (Roche), the cells were centrifuged at 2000 rpm for 5 minutes ...
-
bioRxiv - Cell Biology 2020Quote: ... 50 ng of nick translated probe per coverslip was combined with 12 μg of human Cot-1 DNA (Roche), 10 μg salmon sperm ssDNA (Sigma-Aldrich ...
-
bioRxiv - Cell Biology 2021Quote: ... A 1Kb COL1A1 promoter fragment (GenBank NC_000017.11) was amplified by PCR with a human genomic DNA (Roche, Catalog# 1169111200). The primers were 5′tcggtacctcaccaatgatcacaggcctc and 5′acctcgagaaactcccgtctgctccga including an Acc65I and a XhoI sites ...
-
bioRxiv - Neuroscience 2020Quote: ... Glioma graft cells were labeled by the anti-human Vimentin antibody (mouse monoclonal, V9, 790-2917, Roche, pre-diluted), followed by a mouse secondary antibody (rabbit polyclonal anti-mouse biotin antibody ...
-
bioRxiv - Immunology 2024Quote: ... NK cells were cultured for the indicated amount of time with or without human IL-2 (TECINTM; teceleukin, ROCHE), human IL-15 (247-IL/CF ...
-
bioRxiv - Neuroscience 2023Quote: Human induced pluripotent stem cell (iPSC) line KYOU-DXR0109B (ATCC) was routinely cultured on growth-factor reduced Matrigel (Roche) in mTeSR1 culture medium (StemCell Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC) and liver (human hepatocellular carcinoma, HepG2) cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Microbiology 2020Quote: Damage to the human colon epithelial cell line HT-29 was assessed using a lactate dehydrogenase (LDH) cytotoxicity detection kitPLUS (Roche), which measures the release of the LDH enzyme in the growth medium ...
-
bioRxiv - Cell Biology 2020Quote: ... MEFs were seeded subconfluently o/n (unless indicated otherwise) onto coverslips acid-washed and coated with human fibronectin (25 μg/ml, #11051407001, Roche), as described (Dimchev and Rottner ...
-
bioRxiv - Cancer Biology 2022Quote: ... All embryonic histology slides and human tissue microarray (BioMax, U.S. #BC001134b) slides were scanned using a Ventana DP200 slide scanning system (Roche Diagnostics) at 20x magnification ...
-
bioRxiv - Genetics 2020Quote: A comprehensive list of coordinates of all the exonic and conserved regulatory elements from human X chromosome was used to design a customized capture library from Roche, NimbleGen (Supplementary Table 1) ...
-
bioRxiv - Cell Biology 2021Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Developmental Biology 2021Quote: H9 human pluripotent stem cells were maintained in E8 media and passaged every four days onto matrigel-coated plates (Roche). ESCs ...
-
bioRxiv - Cancer Biology 2022Quote: ... Between 50 and 100 ng of RNA was used as input for the KAPA RNA HyperPrep Kit with RiboErase (Human/Mouse/Rat) library preparation (Roche) on an automated liquid handling platform (Beckman Coulter) ...
-
bioRxiv - Molecular Biology 2024Quote: ... To detect for DNA containing complementary sequences on membrane-bound DNA a α-32P-dCTP-labelled probe spanning the region of 37-611 nts on human mtDNA was synthesized using High Prime DNA Labeling Kit (Roche). After pre-hybridizing the membrane with Church’s buffer (250 mM NaPi pH 7.2 ...
-
bioRxiv - Cell Biology 2023Quote: ... CD4+ T-cells were plated in 200ul of medium (RPMI, 10% human serum) containing IL-2 (Roche, 10 IU/mL) and IL-7 (Peprotech ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... kidney (human primary renal proximal tubule epithelial cells, RPTEC), and liver (human hepatocellular carcinoma, HepG2) [45–50] cells were assessed using a standard WST-1 (Roche) cell viability assay ...
-
bioRxiv - Biochemistry 2023Quote: Cytotoxicity assays were performed as described29 (with minor changes. Proliferation of human cells was assessed using an MTT colorimetric assay (Cell Proliferation Kit I, Roche). HeLa (epithelial cells ...
-
bioRxiv - Immunology 2023Quote: K2 cells or human neutrophils were lysed with 150-200 µl of lysis buffer (supp. Table 2) supplemented with 1X complete inhibitor (Roche) and incubated for 10 min at 4 °C ...
-
bioRxiv - Neuroscience 2023Quote: Frozen brain tissues from human and animals were used to prepare 10% (w/v) homogenates in RIPA buffer containing PI and PhosStop (Roche). Briefly ...
-
bioRxiv - Developmental Biology 2024Quote: Human pluripotent stem cells (hPSCs) were maintained in E8 medium and passaged every 4 days onto matrigel-coated plates (Roche). The following hPSC lines were used in the study ...
-
bioRxiv - Cancer Biology 2024Quote: ... The CD8+ and FoxP3+ cells present in these human tissues were identified by immunohistochemistry double stain using a DISCOVERY ULTRA automated stainer (Roche) followed by analysis using CaloPix ...