Labshake search
Citations for Roche :
351 - 400 of 7626 citations for 6 Quinoxalinecarboxamide 1 2 3 4 tetrahydro 3 oxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... the cells were lysed in 50 µl of lysis buffer (10 mM Tris-HCl pH 7.4, 10 mM NaCl, 3 mM MgCl2, 0.1% NP-40, 1× Roche Complete protease inhibitors cocktail) by pipetting up and down ...
-
bioRxiv - Physiology 2020Quote: ... Sigma Aldrich) with 3% bovine serum albumin (BSA, 735078, Roche Diagnostics GmbH, Mannheim, Germany), 20 µg/ml gentamicin (G1397 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and measured each at least 3 times (technical replicates) in the LightCycler96 (Roche, Germany). We detected expression using SYBRgreen marker (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... DENV-3 RNA was amplified by qRT-PCR (LightCycler Multiplex RNA Virus Master, Roche), using primers to the conserved 3’UTR ...
-
bioRxiv - Neuroscience 2022Quote: ... probe 5’-/5Cy5/TGCAGATCTTCGTGAAGACCTGAC/3IAbRQSp/-3’) measured on a LightCycler 480 Instrument II (Roche). Samples were normalized to 160 pg/μL ...
-
bioRxiv - Plant Biology 2021Quote: ... Probes were labelled with the DIG Oligonucleotide 3’-End Labelling Kit 2nd generation (Roche) with probe sequences listed in Table S1 ...
-
bioRxiv - Immunology 2022Quote: ... containing 3 mL of RPMI media with 70 μg / mL of Liberase TM (Roche) and 30 μg / mL of Dnase I (Roche) ...
-
bioRxiv - Immunology 2019Quote: Mouse lungs were homogenized in HEPES buffer with Liberase Blendzyme 3 (70ug/ml; Roche) and DNaseI (30ug/ml ...
-
bioRxiv - Biophysics 2020Quote: ... The oocytes were treated with collagenase A (3 mg/ml; Roche (Grenzach-Wyhlen, Germany)) for 105 min in Ca2+-free Barth’s solution containing (in mM ...
-
bioRxiv - Plant Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3’end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Immunology 2023Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Microbiology 2024Quote: ... and specific primers (Table 3) on the LightCycler 480 Real-Time PCR System (Roche). Fold change was calculated using the comparative 2-ΔΔCt method ...
-
bioRxiv - Genetics 2021Quote: ... each sample was amplified in 6/2 PCR reactions (2 µg DNA/reaction) in the primary/secondary screens using the ReadyMix Kapa polymerase (Roche) with a total of 20 cycles and an annealing temperature of 55°C (Primer sequences in Table S4 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% NP40, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 0.1mM Na3VO4, 4 μg/ml leupeptin, one Roche cOmplete™ protease inhibitor tablet ...
-
bioRxiv - Cell Biology 2019Quote: ... 5 μg/ml taxol, 3 U/ml DNAse I, 10 μg/ml RNAse A, 1 U/ml micrococcal nuclease, and Roche Complete Protease Inhibitors) and vortexed vigorously for 1 min ...
-
bioRxiv - Biochemistry 2020Quote: ... 5 mM MgOAc, 5 %w/v glycerol, 0.25 %w/v NP-40, 3 mM DTT, 1 mM PMSF, Roche protease inhibitor cocktail (PIC), pH 7.5 ...
-
bioRxiv - Plant Biology 2024Quote: ... Samples were mounted in Citifluor AF1(Agar Scientific, Cat No: AGR1320)/PBS solution (3:1) with (optional a DAPI (Roche, Cat No: 10236276001) to a final concentration of 10µg.ml−1 ...
-
bioRxiv - Genetics 2019Quote: ... The libraries were PCR amplified with KAPA HiFi for 4-6 cycles (KAPA Biosystems, Boston, MA). The final libraries were purified with two 0.7x AMPureXP bead cleanups ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Wings were stained at room temperature for 4-6 h in BM Purple (Roche Applied Science).
-
bioRxiv - Genetics 2021Quote: ... with 3x protease inhibitors (cOmplete Protease Inhibitor Cocktail EDTA-free - 1 mM phenylmethylsulfonyl fluoride, 4 mM benzamidine, 2 μg/ml leupeptin, and 1 μg/ml pepstatin, Roche Diagnostics, cat. number 1187358001) and 3x phosphatase inhibitors (Millipore Inhibitor Cocktail Set ...
-
bioRxiv - Biochemistry 2020Quote: ... supplemented with protease inhibitors (4-(2-aminoethyl)benzenesulfonyl fluoride hydrochloride (Roche), benzamidine ...
-
bioRxiv - Physiology 2020Quote: ... containing 0.2 mg 4-(2-aminoethyl)-benzene-sulfonyl fluoride (AEBSF, Roche). Serum from blood samples was obtained by centrifugation at 3,000 rpm for 15 min ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 % SDS and 5 mM EDTA) supplemented with 1x complete protease inhibitor cocktail (Roche, Switzerland) and 1 mM phenylmethylsulfonyl fluoride ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then pelleted and washed 3 times with PBS containing protease inhibitor (Roche, 11873580001). The pellets were snap-frozen and stored at -80°C for later use ...
-
bioRxiv - Cell Biology 2020Quote: ... as well as AP substrate consisting of 5-bromo-3-chloro-indolyl phosphate (Roche Diagnostics) and 4-nitro blue tetrazolium chloride (Roche Diagnostics ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were lysed at 3 days in ice-cold RIPA buffer containing protease inhibitors (Roche) and protein concentration was determined by BCA Assay (Gibco BRL ...
-
bioRxiv - Genomics 2019Quote: ... beads were washed 3×1mL with bead wash buffer (1x PBS, 5mg/mL BSA, Roche complete EDTA-free protease inhibitor ...
-
bioRxiv - Molecular Biology 2022Quote: To determine the repM transcription start site a 2nd Generation 5’/3’ RACE Kit (Roche) was used according to the manufacturer’s instructions with some modifications ...
-
bioRxiv - Developmental Biology 2023Quote: ... Primer2: 5’-CAAGCAGAAGACGGCATACGA*G-3’) and 15µl 2x Kapa HiFi HotStart Ready Mix (Kapa Biosystems), amplification was performed for 45 s at 98°C ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were then prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Physiology 2023Quote: ... 3 µL of Light Cycler 480 SYBR® Green I Master mix (Roche Diagnostics, Switzerland), 0.24 µL of each primer (10X ...
-
bioRxiv - Genomics 2023Quote: ... For 3-color detection the following antibody dilutions were made: anti-digoxigenin (Roche, cat. 11333089001) 1:10 ...
-
bioRxiv - Genomics 2020Quote: ... Real-time quantitative PCR reactions were set up in triplicate with 2 μL of cDNA (1:4 dilution) per reaction using the FastStart Universal SYBR Green Master mix (Rox) (Roche) and run on a 7500 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 200 mM NaCl, 1% NP-40, 2 mM MgCl2, 10% glycerol, NaF +Na3VO4, complete mini tablets without EDTA, Roche). Lysates were incubated on ice for 15 minutes and centrifuged at 17,000xg at 4°C for 10 minutes ...
-
bioRxiv - Cancer Biology 2023Quote: ... Samples were then washed 2 × 5 min at 4 °C with cold 1 × PBS containing protease inhibitor cocktail (Roche, #4693132001), snap frozen and stored at −80°C until awaiting further processing ...
-
bioRxiv - Microbiology 2020Quote: ... RNA was reverse transcribed using Transcriptor High Fidelity cDNA Synthesis Kit and a specific 3’-UTR DENV-1 primer (Roche Applied Science, Mannheim, Germany), d1a5B 5’-AGAACCTGTTGATTCAACRGC-3’ (62) ...
-
bioRxiv - Cancer Biology 2023Quote: ... 6 µl of MNase (1 mg/ml; Nuclease S7, Roche) was added to the lysate ...
-
bioRxiv - Immunology 2021Quote: ... Reverse: 3’-GGTCCACCAAACGTAATGCG-5’) were performed using KAPA SYBR FAST ONE-STEP qRT-PCR kits (Roche) according to manufacturer’s instructions on a Lightcycler 480 Instrument-II (Roche).
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Immunology 2020Quote: ... 5’-AGCTTGGGACAATGGTAAGG-3’ and FastStart Essential DNA Green Master on a LightCycler 96 system from Roche according to manufacturer’s instructions ...