Labshake search
Citations for Roche :
451 - 500 of 7626 citations for 6 Quinoxalinecarboxamide 1 2 3 4 tetrahydro 3 oxo 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Pathology 2020Quote: C-reactive protein was measured using the Tina-quant C-Reactive Protein Gen.3 reagent (Roche, Basel, Switzerland) designed to achieve very high sensitivity ...
-
bioRxiv - Immunology 2019Quote: ... mouse lungs were removed and gently homogenized in HEPES buffer containing Liberase Blendzyme 3 (70 mg/ml; Roche) and DNaseI (30 mg/ml ...
-
bioRxiv - Cell Biology 2019Quote: ... PBS-washed and nonspecific endogenous peroxidase activity was quenched with a 3% (v/v) hydrogen peroxidase solution (Roche) for 10 min ...
-
bioRxiv - Genetics 2022Quote: ... Precise knock-in of 3’ homologous arm was evaluated by PCR using KAPA2G Fast HotStart ReadyMix (KAPA Biosystems) with a primer set (5’-CCACTAGTTCTAGAGCGGC-3’ and 5’-GAACTGTTGGCTACTAACACTAATACTG-3’ ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries were then prepared from 3 ng of CUT&RUN DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Microbiology 2022Quote: ... The DNA probes were 3′ end-labelled using digoxigenin (DIG)-11-ddUTP and terminal transferase (Roche, Basel, Switzerland). Binding of TFRs to DNA was analyzed using the DIG Gel Shift Kit ...
-
bioRxiv - Microbiology 2022Quote: Cells were lysed in RIPA buffer (50 mM Tris-HCl pH 7.6, 150 mM NaCl, 3 mM MgCl2, 10% glycerol, 0.5% NP-40, cOmplete EDTA-free Protease Inhibitors [Roche]) and then clarified by centrifugation at 21,000 x g for 10 min at 4°C ...
-
bioRxiv - Immunology 2023Quote: ... and single-cell suspensions of lung mononuclear cells were prepared by Liberase Blendzyme 3 (70 ug/ml, Roche) digestion containing DNaseI (30 µg/ml ...
-
bioRxiv - Molecular Biology 2023Quote: ... a total of 0.4–0.5 μg of plasmid and dsRNAs were transfected into BmN4 cells (4–6 × 104 cells per glass bottom 35 mm dish) with X-tremeGENE HP DNA Transfection Reagent (Merck Millipore/Roche) and cells were fixed 5–6 days later ...
-
bioRxiv - Cell Biology 2020Quote: ... 2 mL of the culture was then treated with either 5 µl of MeOH or LMB dissolved in 7:3 MeOH:H2O solution (Roche) at a final concentration of 50 ng/mL for 45 min before imaging.
-
bioRxiv - Molecular Biology 2020Quote: ... Cells were washed twice with 0.1% Triton-X in PBS and blocked with 3% BSA (constituted from powder BSA, Roche Fraction V ...
-
bioRxiv - Molecular Biology 2019Quote: ... 5–10 × 106 HEK-293 or MEF cells were washed with cold sucrose-containing solution I (0.5 M sucrose, 3 mM MgCl2 with Cocktail protease inhibitor, Roche), harvested by scraping into 1 ml solution I and sonicated in a BioRuptor for 10 cycles (15 sec ON/15 sec OFF) ...
-
bioRxiv - Neuroscience 2019Quote: ... The plates were then washed 3 times with ~300 μl of wash buffer (0.05%Tween in PBS) and blocked with 150 μl of 3% BSA (Fraction V, protease-free, Roche Diagnostics Corporation ...
-
bioRxiv - Immunology 2021Quote: ... The pancreas was inflated via the common bile duct by adding ∼3 ml of 0.8mg/ml Collagenase P (Roche) and 10µg/ml Dnase I (Roche ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were then washed 3 times for 5 min each in PBST and blocked with 1X Blocking Reagent (Roche) in PBST ...
-
bioRxiv - Cell Biology 2021Quote: ... 12-20 ml of pre-warmed to 37 °C enzyme buffer solution (EBS) with 2.3 U of Liberase Blendzyme 3 recombinant collagenase (Roche) were cannulated into the vena cava to isolate hepatocytes ...
-
bioRxiv - Microbiology 2021Quote: ... 200 μg each lysate was pre-cleared with 20 μl of Protein A agarose beads (3 mg/ml, Roche) in 200 μl for 1 hour at 4°C on a Labquake Rotator (Barnstead Thermolyne) ...
-
bioRxiv - Cell Biology 2020Quote: RACE-cDNA was synthesized according to the manufacturer’s protocol for 5’/3’ RACE Kit 2nd generation (Roche; Cat.No. 03353621001). The 2648-bp cDNA was cloned into the NheI-XhoI site in pcDNA 3.1 plasmid to obtain pcDNA3.1-DR5-AS and was verified by sequencing ...
-
bioRxiv - Cell Biology 2022Quote: ... The pellet was resuspended with 3 ml S1 solution (0.25 M sucrose, 10 mM MgCl2, 1x Complete protease inhibitor cocktail (Roche)) by pipetting up and down ...
-
bioRxiv - Physiology 2022Quote: ... for 3 min and incubated twice for 3 min with CSK buffer containing 0.5% Triton X-100 and complete protease inhibitors cocktail (catalog no. 11873580001, Roche). Cells were after washed with PBS-S ...
-
bioRxiv - Developmental Biology 2020Quote: ... Sorted cells were pelleted for 5 min with 2000 rpm at 4°C and resuspended in 500 ul hypotonic buffer (HB; 20mM Tris-HCl, pH7.5, 10mM NaCl, 3 mM MgCl2) with added protease inhibitor (Roche). After 30min incubation on ice ...
-
bioRxiv - Immunology 2020Quote: Mice were euthanized and lungs were gently homogenized in HEPES buffer containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNaseI (30 μg/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 0.5 mM CaCl2 and 1 mM MgCl2 ...
-
bioRxiv - Neuroscience 2020Quote: ... then the beads were washed 3 × with washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Neuroscience 2020Quote: ... the beads were washed 3 × in washing buffer (20 mM Tris, 150 mM NaCl, 0.5 % Triton-X-100, complete protease inhibitor cocktail (Roche)) that was either substituted with 2 mM EGTA or 100 μM CaCl2 ...
-
bioRxiv - Genomics 2021Quote: ... followed by lysing the cells on ice for 3 min in 50 μl of ATAC-seq RSB containing 0.1% NP40 (Roche), 0.1% Tween-20 (Roche) ...
-
bioRxiv - Neuroscience 2022Quote: ... 3 mL of Tris (pH = 8.5) and 3 tablets each of the protease/phosphatase inhibitors PhosStop and Complete Mini (Roche). Tissues were then lysed in Precellys Homogenizer Bertin (program 6 x 20s pulse ...
-
bioRxiv - Physiology 2023Quote: ... according to the manufacturer’s protocol and were transcribed into cDNA with the 2nd generation 5’/3’ RACE Kit (Roche) in combination with the Expand High Fidelity PCR System (Roche ...
-
bioRxiv - Plant Biology 2023Quote: ... except that 2 g of fresh weight whole seedlings were harvested for each genotype (3 biological replicates each) and 1.5 ug of anti-HA 3F10 (Roche) antibody were used for immunoprecipitation ...
-
bioRxiv - Molecular Biology 2022Quote: Dried peptides were re-dissolved in 212 µL of pyro-glu buffer (16 mM NaCl, 0.5 mM EDTA, 3 mM cysteamine and 50 μM aprotinin (Roche)) ...
-
bioRxiv - Molecular Biology 2022Quote: ... two PCR reactions were performed with PCR anchor primer (included in the 2nd Generation 5’/3’ RACE Kit, Roche) and GB3 (oligo 61 ...
-
bioRxiv - Neuroscience 2023Quote: ... tissue sections (3-5μm) from frontal cortex (BA 8/9) using the Nexes station automated system (Ventana Medical System Inc., Roche). Deparaffinised and rehydrated sections were pretreated and blocked ...
-
bioRxiv - Neuroscience 2024Quote: ... Ganglia were then treated for 20 min at 37°C with 3 mg/ml collagenase (type I; Roche Diagnostics) and 3 mg/ml dispase II (Roche Diagnostics ...
-
bioRxiv - Synthetic Biology 2023Quote: ... Cells were then washed with PBS 3 times and lysed with RIPA buffer supplemented with protease inhibitor cocktail (Roche), 0.1% Benzonase (Millipore-Sigma) ...
-
bioRxiv - Molecular Biology 2024Quote: ... the “tracrRNA U6.3 promoter” fragment was amplified with left (AAGATATCCGGGTGAACTTCGN19GTTTTAGAGCTAGAAATAGC) and right (GCTATTTCTAGCTCTAAAACN19CGACGTTAAATTGAAAATAGG) sgRNA primers from pUC 3GLA U6.1/3 sgRNA using Pwo polymerase (Roche) with initial 30 sec denaturation at 94°C followed by two cycles 94°C/30 sec ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 µg of plasmid was used for transient transfection using X-tremeGENE™ HP DNA Transfection Reagentreagent (Roche, 6366236001) following the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2022Quote: ... Cell viability was measured 6 days post transfection using WST-1 reagent (Roche). Cells were incubated with 10 μl of WST-1 per 100 μl of media for 1 hour and absorbance was read at 450 and 630 nm ...
-
bioRxiv - Genomics 2023Quote: ... 6 μL of Ligation-1 mix (3.75 U T4 DNA ligase (Roche, 10799009001), 33.3 mM DTT (Invitrogen ...
-
bioRxiv - Microbiology 2023Quote: ... Pools of 6 ganglia were homogenized in 1 ml TriPure isolation reagent (Roche) using lysing matrix D on a FastPrep24 instrument (3 cycles of 40 seconds at 6 m/s) ...
-
bioRxiv - Microbiology 2023Quote: ... Pools of 6 ganglia were homogenized in 1 ml TriPure isolation reagent (Roche) using lysing matrix D on a FastPrep24 instrument (3 cycles of 40 seconds at 6 m/s) ...
-
bioRxiv - Neuroscience 2020Quote: ... levodopa (Madopar®, Roche, Levodopa/carbidopa, ratio 4:1) was administered twice daily for 4-5 months at an individually-tailored dose designed to produce a full reversal of the parkinsonian condition (p.o ...
-
bioRxiv - Cancer Biology 2022Quote: ... expanded to passage 4 and transfected with RCAS-PDGFB-HA or RCAS-shp53-RFP using a Fugene 6 Transfection kit (Roche, 11814443001). Cells were cultured with DMEM media (Gibco ...
-
bioRxiv - Cell Biology 2019Quote: ... pH 7.6, 150 mM NaCl, 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, and 1 x protease inhibitors [Roche]) was added per well ...
-
bioRxiv - Immunology 2021Quote: ... Control siRNA (qiagen) and CXCR4 siRNA (SMARTPool, Dharmarcon) were diluted in DOTAP (1,2-dioleoyl-3-trimethylammonium-propane; Roche Applied Sciences). The mix was gently mixed and incubated at room temperature for 15 min ...
-
bioRxiv - Molecular Biology 2022Quote: In vitro transcribed RNA was prepared from linearized plasmid containing the human PTH 3’-UTR (68) using a Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase ...
-
bioRxiv - Molecular Biology 2020Quote: ... were generated by transfection of 3×FLAG-tagged LRRK2 (WT) plasmid followed by pharmacological selection using an antibiotic G-418 (Roche). Transfection of plasmids and siRNA was performed using Lipofectamine 3000 (Thermo Fisher Scientific ...
-
bioRxiv - Developmental Biology 2022Quote: ... samples were incubated with 27 µl labeling solution plus 3 µl enzyme solution (In Situ Cell Death Detection Kit, AP, Roche) at 37°C overnight ...
-
bioRxiv - Physiology 2019Quote: ... for 45 seconds at 6,000 rpm x 3 (5 minutes on ice in between intervals) using a Roche Magnalyser instrument (Roche, Germany) and homogenization tubes containing ceramic beads (MagNA Lyser Green Beads ...
-
bioRxiv - Biochemistry 2019Quote: ... washed in 15 ml of sucrose-MOPS buffer (250 mM sucrose, 20 mM 3-morpholinopropanesulfonic acid, pH 7.4, supplemented with complete EDTA-free protease inhibitors, Roche, Switzerland) and resuspended in 4 ml of sucrose-MOPS buffer ...
-
bioRxiv - Microbiology 2019Quote: ... small pieces of cryotissue were homogenized 3 times for 30s at 6500rpm using the MagNALyzer ® instrument (Roche Molecular Systems) with buffer RTL and β-mercaptoethanol (according to the manufacturer’s instructions) ...