Labshake search
Citations for Roche :
351 - 400 of 8282 citations for 6 OXO 1 2 DIHYDRO 6H PYRROLO 3 2 1 IJ QUINOLINE 5 CARBOXYLIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... at 4 °C for 4 hr and washed two times with its resuspending buffer and once with E100 buffer (25 mM HEPES-KOH pH7.5, 10 % glycerol, 100 mM KCl, 2 mM MgCl2, 1 mM EDTA with Roche cOmplete™ ...
-
bioRxiv - Microbiology 2020Quote: ... pellets were re-suspended in 1.2 mL of Lysis Buffer (50 μg/ml lysozyme, 0.8% NP-40, 1 mM MgCl2, 1x protease inhibitors [Roche; cOmplete Protease Inhibitor Cocktail] in PBS) ...
-
bioRxiv - Cell Biology 2021Quote: ... Cell pellet samples were collected and re-suspended in lysis buffer (100 mM Tris-HCl, pH 7.4, 100 mM NaCl, 10% glycerol, 1% Triton X-100, 2 mM EDTA, Roche complete protease inhibitor set ...
-
bioRxiv - Cell Biology 2021Quote: ... 1 mM DTT, 1 mM PMSF, 26.3 μM MG-132 [Chemscene, New Jersey, USA], 2 cOmplete EDTA-free protease inhibitors [Roche, Basel ...
-
bioRxiv - Genomics 2022Quote: ... Beads were washed twice 10 min with cold buffer I (150 mM NaCl, 1% Triton X-100, 0.1% SDS, 2 mM EDTA, protease inhibitor cocktail (Roche)) ...
-
bioRxiv - Plant Biology 2021Quote: ... 1 μL of bromophenol blue and 50 mM DTT) containing 2 mM PMSF and cOmplete protease inhibitor cocktail (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: Whole cerebral organoids were washed three times in 1× PBS and dissociated in 2 mL of Accutase (StemPro) containing 0.2 U/μL Dnase I (Roche) for 45 min at 37°C ...
-
bioRxiv - Cell Biology 2021Quote: ... 1% Triton X- 100, 2 mM EDTA, 20 mM Tris, pH 8.1, 150 mM NaCl, and protease inhibitors; Roche), and then washed once with 1 ml of “high-salt buffer” (the same but with 500 mM NaCl ...
-
bioRxiv - Molecular Biology 2020Quote: ... The sections were then rinsed with 2× SSC and 0.2× SSC and treated with alkaline phosphatase– conjugated anti-digoxigenin (anti-DIG, 1:500; Roche) for 2 h at room temperature ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and lysed by sonication in prenylation buffer (50 mm HEPES, pH 7.2, 50 mm NaCl, 2 mm MgCl2, 100 μm GDP, 1× Roche complete EDTA-free protease inhibitor cocktail) ...
-
bioRxiv - Microbiology 2021Quote: ... 1% Triton X-100, 2 mM EDTA, 20 mM Tris-HCl PH8.0, 150 mM NaCl, complete protease inhibitor [Roche]), high salt (0.01% SDS ...
-
bioRxiv - Molecular Biology 2019Quote: For the generation of mass spectrometry samples the beads were washed 4 times with EBC-2 buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1 mM EDTA, and protease inhibitor cocktail (Roche)) and 2 times with 50 mM ammonium bicarbonate followed by overnight digestion using 2.5 µg trypsin at 37 °C under constant shaking ...
-
bioRxiv - Cell Biology 2021Quote: ... Samples were dissociated in 1-2 ml of digestion mix (D-PBS, 250ug/ml Liberase TL (Roche; cat: 5401020001), 0.1 mg/ml DNaseI (Sigma ...
-
bioRxiv - Cell Biology 2020Quote: ... and cells were lysed with TNE-lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% NP40, and complete protease inhibitors, Roche) and prepared for SDS-polyacrylamide gel electrophoresis (SDS-PAGE).
-
bioRxiv - Microbiology 2021Quote: ... and the pellet was resuspended in 1-2 ml of lysis buffer (50 mM Tris-HCl, pH 8.0; 150 mM NaCl; protease inhibitor [Roche]), depending on the size of the cell pellet ...
-
bioRxiv - Cancer Biology 2022Quote: Cell lysates were prepared in lysis buffer (1% Triton, 1 mM DTT, 2 mM EDTA, 20 mM Tris pH 7.5 containing complete protease inhibitor, and PhosStop; Roche) from early (day 6-10 ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 mM EDTA, 0.5% NP-40, 1 mM DTT, 1X protease inhibitor [EDTA-free complete Protease Inhibitor Cocktail, Roche, 11873580001] and 1:100 phosphatase inhibitor [Sigma-Aldrich ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% NP40, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 0.1mM Na3VO4, 4 μg/ml leupeptin, one Roche cOmplete™ protease inhibitor tablet ...
-
bioRxiv - Neuroscience 2023Quote: ... cells were transfected with Tau P301L-V5 encoding full length human tau with P301L mutation and V5 tag (GKPIPNPLLGLDST) and TFEB-GFP at a 2:1 ratio of tau:TFEB (X-tremeGENE 9, Roche). 24 hours later the media was changed and 40 µL of Pff was added to the culture along with 200 nM Bafilomycin (Sigma ...
-
bioRxiv - Biochemistry 2023Quote: ... cells were lysed with TNE-lysis buffer (50 mM Tris, pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% NP40, and complete Protease Inhibitors, Roche) for 30 min on ice then spun down at 11,000 rpm for 10 min ...
-
bioRxiv - Neuroscience 2023Quote: ... rat cortical neurons cultured as described above were lysed directly in buffer (50 mM HEPES pH 7.0, 2% SDS, 1 mM EDTA plus protease inhibitor mixture (PIC, Roche) and 20 mM MMTS (to block free thiols) ...
-
bioRxiv - Immunology 2023Quote: ... and incubated on ice for 1 hr and washed twice with Buffer 2 (0.05% w/v Saponin, 1X Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Cell Biology 2023Quote: ... The clarified lysate was then diluted 3.75 times using dilution buffer (10 mM Tris–HCl, pH 7.4, 2 mM EDTA, 1 mM DTT, protease inhibitor cocktail tablet (cOmplete, Roche) and phosphatase inhibitor (phosSTOP ...
-
bioRxiv - Immunology 2023Quote: ... and incubated on ice for 1 hour and washed twice with Buffer 2 (0.05% w/v Saponin, 1X Roche cOmplete EDTA-free Protease Inhibitor ...
-
bioRxiv - Biochemistry 2023Quote: ... benzonase (to 1 µg/mL) and cOmplete EDTA-free Protease Inhibitor Cocktail (Roche, 2 tablets/L initial culture volume). The suspension was frozen and stored at −80 °C ...
-
bioRxiv - Molecular Biology 2023Quote: ... Bacteria were harvested by centrifugation and resuspended in 20 mL of lysis buffer (50 mM Tris pH 7.5, 300 mM NaCl, 2 mM MgCl2 and 1 mM DTT, 1X Roche EDTA-free Complete protease inhibitor cocktail) ...
-
bioRxiv - Biochemistry 2023Quote: ... benzonase (to 1 µg/mL) and cOmplete EDTA-free Protease Inhibitor Cocktail (Roche, 2 tablets/L initial culture volume) were added to the cell suspension and stirred at RT for 30 mins ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... cells were lysed with TNE-lysis buffer (50mM Tris, pH 7.4, 150 mM NaCl, 2 mM EDTA, 1% NP40, and cOmplete protease inhibitors, Roche) and prepared for SDS-polyacrylamide gel electrophoresis (SDS-PAGE) ...
-
bioRxiv - Developmental Biology 2023Quote: ... samples were incubated in 50% Hybridization Buffer (50% formamide, 2x SSC, 1 mg/ml Torula RNA, 0.05 mg/ml Heparin, 2% Roche blocking reagent ...
-
bioRxiv - Neuroscience 2024Quote: ... and blocked for 1 hour in blocking buffer consisting of 20% sheep serum and 2% blocking reagent (11096176001, Roche) in MABT ...
-
bioRxiv - Biochemistry 2024Quote: ... resuspended in extraction buffer (SDS 2%, 50 mM Tris-Cl pH 7.4, 1 mM PMSF, 2x cOmplete protein inhibitor cocktail (Roche)) ...
-
bioRxiv - Biochemistry 2022Quote: ... pellets were resuspended in lysis buffer (50 mM HEPES pH 8, 400 mM NaCl, 75 mM Imidazole pH 8, 5% v/v glycerol, 5 mM 2-Mercaptoethanol, supplemented with Roche Protease Inhibitor Tablets) and lysed using an Emulsiflex-05 homogenizer ...
-
bioRxiv - Neuroscience 2021Quote: ... 5mM K4Fe(CN)6 and 1 mg/mL of X-gal (Roche) until precipitate was sufficient to visualize ...
-
bioRxiv - Biochemistry 2020Quote: ... 6 μM EF-Tu was pre-incubated with 1 mM GTP (Roche) in Reaction Buffer for 5 minutes at 37°C and then was supplemented with 4 μM Val-tRNAVal (all final concentrations) ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM β-mercaptoethanol) with 2 mM phenylmethylsulfonylfluorid (PMSF) or EDTA-free protease inhibitor cocktail tablet (Roche), 20 mg lysozyme (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... 80 mM KCl, 0.2 mM spermine, 5 mM 2-ME, 0.5 mM spermidine, 0.2% IGEPAL CA-630, Roche mini EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Cancer Biology 2019Quote: ... 0.1% SDS, 1% deoxycholic acid, 0.5 mM PMSF, 1 mM DTT, 0.1 mM sodium orthovanadate, and Roche protease inhibitors). Nuclear lysates were sonicated with a Branson 250 Sonifier (output 20% ...
-
bioRxiv - Molecular Biology 2022Quote: ... The membrane was transferred to a blocking buffer (1 M maleic acid solution pH7.4, 1% nucleotide blocking reagent (Roche)) for 30 minutes and then incubated in antibody-solution (anti-dioxigenin-AP fragments in blocking buffer) ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Cancer Biology 2023Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Molecular Biology 2020Quote: ... 0.3% 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate (CHAPS)) supplemented with 1X protease inhibitor cocktail (Complete; Roche), 0.5 mM phenylmethylsulfonyl fluoride (PMSF) ...
-
bioRxiv - Cell Biology 2021Quote: ... and phosphatase inhibitors (2 mM activated Na3VO4, 2 mM NaF and 1x PhosSTOP (Roche)) ...
-
bioRxiv - Cancer Biology 2022Quote: ... plates were fixed with 2% paraformaldehyde/ 2% sucrose and stained with DAPI (#10236276001, Roche). Plates were photographed with the IN Cell Analyzer 2200 high content analyzer (GE Healthcare) ...
-
bioRxiv - Neuroscience 2024Quote: ... 0.1% Tween-20] and maintained for 2 hours in 2% blocking reagent (11096176001, Roche) in TNT ...
-
bioRxiv - Immunology 2024Quote: ... 2 mM L-Glutamine (R10) (Thermo 25030081) + 10 IU/mL IL-2 (Roche 11011456001) after CD3/CD28 stimulation ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4°C ...