Labshake search
Citations for Roche :
351 - 400 of 3513 citations for 6 CHLORO 2 METHYL 3 4' BIPYRIDINE 5 CARBONITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... The cell pellet was resuspended in buffer 2 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL CA-630, 10% glycerol, Roche Complete Protease Inhibitor), incubated for 10 min at 4°C followed by centrifugation ...
-
bioRxiv - Microbiology 2020Quote: ... were amplified using primers Sb.1 - Sb.2 and Sb.3 to Sb.8 (Table 2) and labeled with digoxigenin (DIG) using the PCR DIG probe synthesis kit (Roche Diagnostics). Membranes were hybridized with these probes at 65°C and then washed at 68°C with decreasing concentrations (from 2X to 0.2X ...
-
bioRxiv - Immunology 2023Quote: ... coated with 2.5ug/mL aCD3 and re-stimulated for an additional 3 days in complete IMDM-10 supplemented with 50U/mL IL-2 (Roche 11011456001). For Th17 polarizations ...
-
bioRxiv - Microbiology 2019Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Neuroscience 2020Quote: ... the cDNA of our samples were diluted 10 fold and 4 µl were added to a mix of 5 µl FastStart Universal SYBR Green Master (Roche, Germany), 0.4 µl of nuclease-free water and 0.3 µl of forward and reverse primer (see primer sequences in Supplementary Table 1) ...
-
bioRxiv - Immunology 2021Quote: ... incubated over-night (o/n) at 4°C with primary antibody diluted 1:500 in 5% Bovine Serum Albumin Fraction V (Roche 10735086001) in TBS-T ...
-
bioRxiv - Molecular Biology 2023Quote: ... and CBD patients were gently homogenized at 4 °C in 5 mL of TBS buffer containing one tablet of cOmplete™ mini EDTA-free protease inhibitor cocktail (Roche) at a concentration of 20% w/vol using a Dounce homogenizer ...
-
bioRxiv - Microbiology 2023Quote: ... and incubated with primary antibodies (5% milk, TBS-T, overnight, 4°C) at the following dilutions: rat anti-HA (1:1000; Roche Diagnostics), mouse anti-Myc (1:1000 ...
-
bioRxiv - Physiology 2024Quote: ... the samples were blocked with 5% skim milk in PBS-DEPC for 1 hour at 4°C and incubated with anti-DIG antibody (Roche Diagnostics) diluted 1:10,000 in the blocking buffer for 1 hour at 4°C ...
-
bioRxiv - Genomics 2020Quote: ... Real-time quantitative PCR reactions were set up in triplicate with 2 μL of cDNA (1:4 dilution) per reaction using the FastStart Universal SYBR Green Master mix (Rox) (Roche) and run on a 7500 Real-Time PCR System (Applied Biosystems) ...
-
bioRxiv - Developmental Biology 2019Quote: ... probes were synthesized at 37°C for 2-4 hrs in digoxigenin-synthesis reaction mixture with T3 RNA polymerase (Roche). After synthesis ...
-
bioRxiv - Cell Biology 2021Quote: ... pH 7.4, 200 mM NaCl, 1% NP-40, 2 mM MgCl2, 10% glycerol, NaF +Na3VO4, complete mini tablets without EDTA, Roche). Lysates were incubated on ice for 15 minutes and centrifuged at 17,000xg at 4°C for 10 minutes ...
-
bioRxiv - Biochemistry 2022Quote: ... were homogenized in 7x w/v homogenization buffer (320 mM sucrose, 4 mM HEPES–NaOH, 2 mM EDTA, and Complete protease inhibitor mix (Roche), pH 7.4 ...
-
bioRxiv - Microbiology 2022Quote: ... The plate was sealed and centrifuged (2 minutes, 180×g, 4°C) before analysis with the LightCycler 480 Instrument II (Roche; Preincubation ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide using an additional amount of 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Molecular Biology 2020Quote: ... fully 2’O-methylated antisense RNA oligonucleotide in 530 μL medium with 4 μL X-tremeGENE HP DNA transfection reagent (Roche) per 1 μg oligonucleotide ...
-
bioRxiv - Neuroscience 2019Quote: ... The resulting supernatant is the soluble fraction and the insoluble fraction is generated by resuspending the pellet in urea buffer (30 mM Tris, 7 M Urea, 2 M Thiourea, 4% CHAPS, 1X Protease Inhibitor Cocktail (Roche), 0.5 mM PMSF ...
-
bioRxiv - Neuroscience 2021Quote: ... 0.5 % sodium deoxycholate and 1 % Triton X-100 as well as protease inhibitors (10 mg / ml leupeptin, pepstatin A, 4-(2-aminoethyl) benzensulfonyl-fluorid and aprotinin) and phosphatase inhibitors (PhosSTOP−, Roche). Total cell lysates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA was diluted to 2 ng/µL and 4 µL were added to 10 µL 2x FastStart Universal SYBR Green PCR Master (Roche). Each sample was run in triplicate using iTaq Universal SYBR Green Supermix (BioRad ...
-
bioRxiv - Genetics 2023Quote: ... for 30 min at room temperature and incubated for 2 h at room temperature or overnight at 4°C with primary antibodies against GFP (Roche), androgen receptor (Invitrogen) ...
-
bioRxiv - Developmental Biology 2023Quote: ... Probes were synthesized at 37°C for 2–4 hrs in digoxigenin-synthesis reaction mixture with T7 RNA polymerase (Roche). After synthesis ...
-
bioRxiv - Cell Biology 2024Quote: ... the cells were pelleted by centrifugation (750 x g, 2 min, RT) and washed in 4 ml vPBS containing EDTA-free protease inhibitor (Roche). The washed cells were again pelleted by centrifugation (750 x g ...
-
bioRxiv - Cell Biology 2024Quote: ... The cells were pelleted by centrifugation (750 x g, 2 min, 4 °C) and resuspended in 50 μl vPBS containing EDTA-free protease inhibitor (Roche). The cells were fixed by addition of 0.5 ml ice-cold fixation solution (4% (v/v ...
-
bioRxiv - Developmental Biology 2024Quote: ... The samples were then blocked in blocking solution (maleic acid buffer containing 2% Boehringher-Mannheim blocking reagent) and incubated overnight at 4°C in blocking solution containing anti digoxigenin antibody (Roche) diluted at 1:2000 ...
-
bioRxiv - Cell Biology 2019Quote: ... 2 mM MgCl2, 1 mM EGTA, 0.1% [v/v] NP-40, 1 mM DTT, 5% [v/v] glycerol, Roche Complete Protease Inhibitors and PhosSTOP Protein Phosphatase Inhibitors ...
-
bioRxiv - Neuroscience 2020Quote: ... pH 7.5, 150 mM NaCl, 5 mM EDTA, 2 mM ATP, 1 mM dithiothreitol and protease inhibitor cocktail tablets; Roche) using Bead Beater ...
-
bioRxiv - Biochemistry 2020Quote: ... cells were lysed in Buffer A (2 M NaCl, 20 mM HEPES pH 7.5, 20 mM Imidazole, 5 mM βME, protease inhibitor (Roche)) by sonication ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR analysis was performed by mixing 5 μL of 1 μmol·L-1 of both primers and 2.5 μL of 0.25 ng·μL-1 template DNA with 12.5 μL 2× KAPA HiFi HotStart ReadyMix (Roche, Basel, Switzerland). The thermal program was 98°C for 3 min ...
-
bioRxiv - Developmental Biology 2022Quote: ... DIG-labelled cDNA probe was incubated at 95 °C for 10 min and immediately placed in the ice for 5 min before adding to the hybridization buffer (5x SSC, 50 % formamide, 0.02 % SDS, 2 % blocking agent (Roche), DEPC-treated water) ...
-
bioRxiv - Neuroscience 2023Quote: ... cells and sections were processed for BrdU immunodetection following the manufacturer’s recommendations (5-Bromo-2′-deoxy- uridine Labelling and Detection Kit I, Roche). The slides were mounted for fluorescent microscopy in ProLong® Diamond Antifade Mountant with DAPI (Life Technologies).
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2021Quote: ... The pellet was resuspended in Buffer 2 (10 mM Tris-HCl pH=7.5, 2 mM MgCl2, 3 mM CaCl2, 0.5 % IGEPAL CA-630, 10 % glycerol, supplemented with Roche Complete Protease Inhibitor Cocktail), incubated at 4°C for 10 min followed by a centrifugation step ...
-
bioRxiv - Neuroscience 2020Quote: ... the pellet was washed 3 times with the buffer B and transferred in an enzyme solution (2 mg/mL Collagenase/Dispase (Roche, Bale, Switzerland), 0,147 µg/mL TLCK (Lonza ...
-
bioRxiv - Genetics 2021Quote: ... and cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C followed by a centrifugation step ...
-
bioRxiv - Genetics 2021Quote: ... 30 million equivalent cell pellets were then resuspended in 5ml of buffer 1 (10 mM Tris-HCl at pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Roche Complete protease inhibitor), incubated for 20 min at 4°C and collected cells by a centrifugation step ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... 0.18 μL Fugene 6 reagent (Roche, Basel) was added to 4.82 μL serum free medium and incubated for 5 min at RT ...
-
bioRxiv - Neuroscience 2020Quote: ... using random primers p(dN)6 (Roche). Quantitative PCR reactions were performed in a BioRad CFX96 system employing the SYBRgreen fluorescent reagent (Applied Biosystems ...
-
bioRxiv - Neuroscience 2020Quote: ... using FuGENE® 6 (Roche, Basel, Switzerland), using standard procedures ...
-
bioRxiv - Neuroscience 2020Quote: ... using random primers p(dN)6 (Roche). Quantitative PCR reactions were performed using standard protocols using EvaGreenTM in the Stratagene Mx3000P system (Agilent Technologies) ...
-
bioRxiv - Physiology 2023Quote: ... DNA Standards 1-6 (KAPA Biosystems KK4903). The RNA-Seq libraries were normalized to a 2nM concentration and pooled for multiplexed sequencing on the NovaSeq 6000.
-
bioRxiv - Cancer Biology 2023Quote: ... the RNase A (6 µg/mL, Roche) was added or not directly to the reaction mixture ...
-
bioRxiv - Physiology 2023Quote: ... DNA Standards 1-6 (KAPA Biosystems KK4903). Libraries were pooled based on equal molar amounts to 1.9nM for multiplexed sequencing ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA Standards 1-6 (KAPA Biosystems KK4903). The libraries were pooled based on equal molar amounts to 1.85 nM for multiplexed sequencing.
-
bioRxiv - Microbiology 2023Quote: ... using random primers p(dN)6 (Roche). Quantitative real-time PCR was performed on a real-time PCR system (Quant Studio 6 Flex ...
-
bioRxiv - Cell Biology 2024Quote: ... using random primers p(dN)6 (Roche). Quantitative real-time PCR reactions employing SYBRgreen fluorescent reagent and/or EvaGreen™ were performed in the Stratagene Mx3000P system (Agilent Technologies ...
-
bioRxiv - Biophysics 2021Quote: ... 3-((3-cholamidopropyl) dimethylammonio)-1-propanesulfonate (CHAPS, Roche Life Sciences, Indianapolis, IN) micelles and also using 1,2-dihexanoyl-sn-glycero-3-phosphocholine (DHPC)/1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 100 mL of cold lysis buffer (50 mM HEPES pH 8, 175 mM NaCl, 5 % glycerol, 1 mM EDTA and 2 tablets of protease inhibitors by Roche). The bacterial solution was then incubated at room temperature (RT ...
-
bioRxiv - Cell Biology 2019Quote: ... and resuspended in Laemmli sample buffer (2% SDS, 5% β 50 mM Tris-Cl pH 6.8) supplemented with Protease Inhibitor Cocktail and PhosStop (Roche) for isolation of total cellular protein ...
-
bioRxiv - Biophysics 2022Quote: ... 0.5 mM tris(2-carboxyethyl)phosphine (TCEP) supplemented with 1 mM phenylmethylsulfonyl fluoride (PMSF) and EDTA-free protease inhibitors (Roche). The lysate was clarified by centrifugation and the proteins in the supernatant were purified by gravity Ni-nitrilotriacetic acid (Ni-NTA ...