Labshake search
Citations for Roche :
301 - 350 of 3698 citations for 6 CHLORO 2 METHYL 3 4' BIPYRIDINE 5 CARBONITRILE since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2022Quote: Sense and anti-sense DIG-labelled RNA probes were synthesised from 5’ and 3’ regions of tert using DIG RNA Labelling Mix (Roche). A 562bp 3’ region of tert ...
-
bioRxiv - Neuroscience 2022Quote: Mounted coronal cryosections were rinsed in PBS for 3 times (5 min) and thereafter incubated in Blocking Reagent (Roche Diagnostics) for 15 minutes ...
-
bioRxiv - Genetics 2019Quote: ... located in exon 18 and reverse primer 5’-TTGGTGGCTACAAAGACGTG-3’ located in exon 22 using the One Tube reverse transcription-PCR reaction kit (Roche) according to the manufacturer’s instructions ...
-
bioRxiv - Biophysics 2019Quote: ... The central fragment of the molecule is flanked by oligonucleotides labelled either with digoxigenin (3’ end) or biotin (5’ end) that specifically bind either to a glass surface covered with Anti-digoxigenin (Roche) or to superparamagnetic beads (MyOne ...
-
bioRxiv - Neuroscience 2024Quote: ... The sections were subsequently rinsed and incubated in the dark with a NBT/BCIP solution (Nitroblue tetrazolium chloride/ 5-bromo-4chloro-3-indyl-phosphate; Roche) until the staining appeared (overnight or up to 48 h) ...
-
bioRxiv - Molecular Biology 2024Quote: ... Adapters were ligated by adding 15 µL of the ligation mix (3 µL T4 Ligase Buffer 10X, 0.5 µL T4 ligase (5 U/µL, Roche, 10799009001), 0.25 µl of x-Gene Stubby Adapter 50 mM (IDT) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1 mM MgCl2, 0.5 mM β-mercaptoethanol, 1 mM ATP, 1% IGEPAL, 5% glycerol, 3 U/ml Benzonase and Roche Complete EDTA-free protease inhibitor ...
-
bioRxiv - Immunology 2023Quote: ... the common bile duct was clamped and the pancreatic duct was perfused with 3-5 mL solution of collagenase P in HBSS-1% HEPES (Roche). The pancreas was then harvested and transferred to a 50mL conical tube containing 5mL of collagenase P solution and kept on ice until all organs were collected ...
-
bioRxiv - Neuroscience 2023Quote: ... The resulting cDNAs were amplified with primers DP3 and DP5 (5’-GTTCAGAGTTCTACAGTCCGACGATC-3’, 0.5 μM) and KAPA Hifi HotStart DNA polymerase (Roche, KK2601) to the optimal amplification point ...
-
bioRxiv - Biochemistry 2023Quote: ... 100 mM NaCl, 20 mM Imidazole pH 7.5, 3 mM MgCl2, 100 µM EDTA, 5 mM β-Mercapoethanol, 20 µM GDP, Roche cOmplete protease inhibitor cocktail and DNAse I ...
-
bioRxiv - Biophysics 2021Quote: ... 0.1% (v/v) 2-mercaptoethanol and 60 × 10−3 М n-Octyl-β-D-Glucopyranoside) containing protease inhibitor (Roche). Total protein was collected and incubated with anti-p75NTR (Alomone ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche)) and incubated for 20 min at 4°C ...
-
bioRxiv - Molecular Biology 2021Quote: ... Cell pellets resuspended in LB1 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2 supplemented with protease inhibitors [Roche]) for 5 minutes at 4 °C followed by centrifugation (1,000g ...
-
bioRxiv - Biochemistry 2022Quote: ... cells were resuspended in buffer2 (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, Protease inhibitors (Roche), 0.5 % IGEPAL CA-630 ...
-
bioRxiv - Microbiology 2023Quote: ... Cells were resuspended in 1000 µL cold cytoplasmic lysis buffer (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Microbiology 2023Quote: ... cells were resuspended in 1000 µL cold sucrose buffer containing (10 mM HEPES pH 7.9, 10 mM KCl, 2 mM Mg acetate, 3 mM CaCl2, 340 mM sucrose, 1 mM DTT, Roche protease inhibitor cOmplete tablets EDTA to 1× ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Data from 2-3 technical replicates for all three biological replicates were analyzed in LightCycler® 96 software (Roche), Google Sheets ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Immunology 2024Quote: ... at a ratio of 1:3 (cell:bead) in the presence of 2000 IU/mL recombinant human IL-2 (TECIMTM, Hoffman-La Roche provided by NCI repository ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 μl of MNase buffer (0.3 M Sucrose, 85 mM Tris, 3 mM MgCl2, 2 mM CaCl2, 2.5U of micrococcal nuclease: Roche 10107921001) was added in to each tube (0.5 millions of cells per tube) ...
-
bioRxiv - Neuroscience 2020Quote: ... Supernatants from each buffer were dialyzed in 25 mM Tris-HCl and 5 mM EDTA pH 8.0 overnight at 4°C and subsequently digested with 200 mg/ml pronase (Roche). Peptides were precipitated with 5% trichloroacetic acid (TCA ...
-
bioRxiv - Molecular Biology 2020Quote: ... Membranes were blocked in 5% milk and probed overnight at 4°C with 1:2,500 rat anti-HA mAb 3F10 (Roche). They were then incubated for an hour at RT with 1:5,000 anti-rat horseradish peroxidase conjugated antibody (GE Healthcare) ...
-
bioRxiv - Cell Biology 2022Quote: ... before being detached with 40 μL of ice-cold native lysis buffer (80 mM PIPES pH 6.9, 2 mM MgCl2, 4 mM EGTA, 0.2% saponin, 5x cOmplete protease inhibitor cocktail Roche). The lysate was collected in 1.5 mL tube and incubated on ice for 10 min ...
-
bioRxiv - Molecular Biology 2024Quote: ... 500 mM NaCl, 4 mM MgCl2, 2 mM DTT, 1% SDS, 0.5% sodium deoxycholate, 0.5% Igepal, supplemented with Roche Complete Protease Inhibitor cocktail (1 tablet/50 mL)) ...
-
bioRxiv - Molecular Biology 2020Quote: Proliferative capacity of cells was analysed using 5-bromo-2’-deoxy-uridine (BrdU) labelling (Roche, Basel, Switzerland). Cells seeded on coverslips were pulsed with 10 μM BrdU for 60 min at 37°C ...
-
bioRxiv - Cancer Biology 2019Quote: ... The embryos were subsequently incubated in the blocking solution (2%Roche block, 5% calf serum, 1% DMSO). γH2AX antibody (GTX127342 ...
-
bioRxiv - Biochemistry 2021Quote: ... 5 mM β-mercaptoethanol) with 2 mM phenylmethylsulfonylfluorid (PMSF) or EDTA-free protease inhibitor cocktail tablet (Roche), 20 mg lysozyme (Sigma ...
-
bioRxiv - Plant Biology 2023Quote: ... 80 mM KCl, 0.2 mM spermine, 5 mM 2-ME, 0.5 mM spermidine, 0.2% IGEPAL CA-630, Roche mini EDTA-free Protease Inhibitor Cocktail ...
-
bioRxiv - Biophysics 2023Quote: ... 50 mM KCH3COO, 2 mM MgSO4, 1 mM EGTA, 5% glycerol, 0.2mM Mg-ATP, 0.1% Octylglucoside, 0.5mM DTT, Roche cOmplete™ Protease Inhibitor Cocktail EDTA free) ...
-
bioRxiv - Pathology 2021Quote: ... pH7.3, 500 mM NaCl, 45 mM imidazole, 5 mM MgCl2, 10% glycerol, 2 mm ßME, complete protease inhibitor [Roche] at 2 tablets/50 ml of lysate) to a volume in milliliters equal to four times the wet weight of the pellet in grams ...
-
bioRxiv - Microbiology 2020Quote: ... and 3-4 mice/group subcutaneously received 25ng/g of pegylated-human interferon α (Peg-hIFNα-2a) (Hoffmann La Roche, Basel, Switzerland). To activate IFN-1 signaling ...
-
bioRxiv - Biophysics 2019Quote: ... or for confocal in a alkaline-washed glass-bottomed chamber coated with human plasma fibronectin (25 µg/mL at 4°C overnight in 1/3 X MBS; Roche Molecular Biochemicals) in DFA supplemented with antibiotic/antimycotic (Sigma) ...
-
bioRxiv - Cancer Biology 2020Quote: ... and reverse primer 5’ GCAGATGATCCCCTGGGTTG 3’)] were assessed by real-time quantitative RT-PCR on a LightCycler® 480 apparatus (Roche) using the LightCycler® 480 SYBR Green I Master Mix ...
-
bioRxiv - Neuroscience 2020Quote: ... 5 ml of lysis buffer (10 mM Tris, 10 mM NaCl, 3 mM MgCl2, 0.1% Nonidet P40 substitute (Roche/ Sigma, 11754599001), 0.2 U μl−1 RNase inhibitor ...
-
bioRxiv - Genomics 2022Quote: ... were washed twice with PBS/BSA (5 mg/ml BSA) and incubated with 3 μl of anti-Myc (Roche, cat # 11667203001) or anti-Rpb3 (Neoclone ...
-
bioRxiv - Neuroscience 2020Quote: ... they were treated with 3% H2O2 for 10 min to inactivate endogenous peroxidases and then closed in 5% bovine serum albumin (BSA; 10735078001, Roche, Switzerland) for 20 min ...
-
bioRxiv - Biophysics 2023Quote: ... Recombinant baculoviruses were generated by transfecting 2.5 μg of a transfer bacmid into Sf9 cells (2.5 mL at a density of 106 cells/mL) using 3 μL of X-tremeGENE™ HP DNA Transfection Reagent (Roche) and 100 μL Transfection Medium (Expression Systems) ...
-
bioRxiv - Developmental Biology 2024Quote: ... Cryosections were then washed 3 times for 5 minutes in PBT before being incubated with 1:10 TUNEL enzyme buffer (Roche #12156792910) at 37°C in the dark for 2 hours ...
-
bioRxiv - Cell Biology 2020Quote: ... Cell viability was assessed by addition of 5 μl of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (i.e., MTT) using a Cell Proliferation Kit I (Roche Diagnostics, Mannheim, Germany), in accordance with the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2019Quote: ... 10 μL / well of MTT (3- [4,5-dimethylthiazol-2-yl] −0,5-diphenyl tetrazolium bromide (11465007001; Roche Life Science, Mannheim, Germany) labeling reagent (1× ...
-
bioRxiv - Bioengineering 2022Quote: ... and then inflated via the trachea with 2-3 mL of pre-warmed (37°C) enzyme solution (1 mg/mL collagenase/dispase [Roche] ...
-
bioRxiv - Molecular Biology 2019Quote: ... and viability was measured using the Roche MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide) kit (Roche, Cat # 11465007001) according to manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2021Quote: Metabolic activity was determined using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)-assay (Cell Proliferation Kit I, Roche Germany, Mannheim) according to manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... the slides were washed in TBS/T 3 times and then incubated with secondary antibodies (2 µg/ml) and DAPI (1 µg/ml, Roche) for 1 hour at room temperature ...
-
bioRxiv - Neuroscience 2022Quote: ... The beads were then collected at 1000 g for 2 min and washed at least 3 times with lysis buffer coupled with protease inhibitor cocktail (Roche). After last wash and centrifugation ...
-
bioRxiv - Molecular Biology 2024Quote: ... uteri were harvested from pregnant mice at 4.5 days post coitus and washed with cold swelling buffer (10 mM Tris-HCl pH 7.5, 2 mM MgCl2, 3 mM CaCl2, 1X Protease Inhibitor Cocktail (PIC, Roche, 11836170001)) immediately after collection ...
-
bioRxiv - Neuroscience 2021Quote: ... This was spun down (5 minutes at 1800 RMP, 4°C) and the pellet then digested in 10ml collagenase/dispase (1mg/ml; Roche) and DNase I type IV (40µg/ml ...
-
bioRxiv - Microbiology 2020Quote: ... coli cells were resuspended in 200 mL of cold Lysis buffer (50 mM HEPES pH 8, 300 mM NaCl, 1 mM EDTA, 5 % glycerol, 4 tablets of protease inhibitors, Roche). The cells were lysed and the membrane fraction was collected as described in the YukC purification protocol below ...
-
bioRxiv - Neuroscience 2023Quote: ... The larvae were then incubated overnight at 4°C with anti-Dig-AP (1:2000 in 5% normal goat serum, 11093274910, Roche) and washed before detecting alkaline phosphatase using NBP/BCIP(Roche ...
-
bioRxiv - Developmental Biology 2022Quote: ... 1% NP40, 150 mM NaCl, 2 mM EDTA, 50 mM NaF, 0.1mM Na3VO4, 4 μg/ml leupeptin, one Roche cOmplete™ protease inhibitor tablet ...