Labshake search
Citations for Roche :
351 - 400 of 1836 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2023Quote: ... Blocking was completed with 3% BSA protease free (Roche Ref# 03 117 332 001) for 1 hour at RT ...
-
bioRxiv - Developmental Biology 2022Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). 10 picomols of each probe were used for each slide ...
-
bioRxiv - Immunology 2023Quote: ... minced with razor blade and digested enzymatically with 3 mg/mL collagenase/dispase (Roche) at 37 °C for 1 hour ...
-
bioRxiv - Plant Biology 2023Quote: ... and digoxigenin-labeled using a DIG oligonucleotide 3′ end labeling kit (Roche Applied Science). Ten picomoles of each probe were used for each slide ...
-
bioRxiv - Cell Biology 2023Quote: ... the cell samples were incubated with 300 nM DAPI (Cat# 28718-90-3, Roche) in PBS for 15 min and washed three times with PBS ...
-
bioRxiv - Genetics 2023Quote: ... Bound protein/protein complexes were washed 3 times ((1x TBS, 0.5% Nonident P40 (Roche), 1% phosphatase inhibitor cocktail 2 and 3 (Sigma)) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Plant Biology 2024Quote: ... followed by 1-3 days in an NBT/BCIP (Roche, Cat No./ID: 11681451001) solution ...
-
bioRxiv - Immunology 2024Quote: ... containing 3 mL of RPMI media with 70 µg / mL of Liberase TM (Roche) and 30 µg / mL of DNase I (Roche ...
-
bioRxiv - Neuroscience 2024Quote: ... containing 0.5% BSA and 3 mg/mL DNAse I grade II (Roche, Cat# 104159). Once resuspended ...
-
bioRxiv - Biochemistry 2024Quote: ... 3 mM TCEP) containing 1 tablet of complete EDTA-free protease inhibitor cocktail (Roche) and PhosSTOP (PHOSS-RO Roche ...
-
bioRxiv - Pathology 2024Quote: ... washed 3 times with 1 ml of PBS containing protein inhibitors (Complete, Roche, Basel) and then manually homogenized in 250 µl of Tris EDTA buffer (20 mM Tris ...
-
bioRxiv - Immunology 2024Quote: ... and whole transcription amplification (WTA) with KAPA HotStart HIFI 2 3 ReadyMix (Kapa Biosystems) for 18 cycles ...
-
bioRxiv - Immunology 2024Quote: ... lungs harvested in HEPES buffer containing Liberase Blendzyme 3 (70 μg/mL; Roche, #05401020001) and DNaseI (30 μg/ml ...
-
bioRxiv - Biochemistry 2022Quote: ... Cells were incubated for 24 hours and lysed using the Dual-Luciferase Assay lysis buffer supplemented with Roche Complete Protease Inhibitor (Roche, incubation of 10 min on a shaker). Lysates were cleared by centrifugation (13,500 rpm ...
-
bioRxiv - Cell Biology 2020Quote: ... Sections were blocked for 1 hr at room temperature (RT) in 3% BSA (Roche; 10735086001), 0.05% Tween (Sigma ...
-
bioRxiv - Biochemistry 2020Quote: ... samples were then digested for a further 3 hrs with 2 μg Chymotrypsin (Roche 11418467001) at 25°C ...
-
bioRxiv - Developmental Biology 2022Quote: ... Cells were then pelleted and washed 3 times with PBS containing protease inhibitor (Roche, 11873580001). The pellets were snap-frozen and stored at -80°C for later use ...
-
bioRxiv - Immunology 2021Quote: ... 3 × 104 HMEC-1 cells were seeded into an E-16 multi-well plate (Roche) in triplicate and incubated for 72 h ...
-
bioRxiv - Neuroscience 2021Quote: ... cells were lysed at 3 days in ice-cold RIPA buffer containing protease inhibitors (Roche) and protein concentration was determined by BCA Assay (Gibco BRL ...
-
bioRxiv - Biochemistry 2024Quote: ... A ∼3:1 ratio of X-tremeGENE™ 9 DNA Transfection Reagent (Roche, XTG9-RO) was added to the mixture prior to incubation and application on HEK293T cells using standard methods 1 ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were then prepared from 3 ng DNA with the Kapa HyperPrep Kit (Roche) according to the manufacturer’s standard protocol ...
-
bioRxiv - Physiology 2023Quote: ... 3 µL of Light Cycler 480 SYBR® Green I Master mix (Roche Diagnostics, Switzerland), 0.24 µL of each primer (10X ...
-
bioRxiv - Genomics 2023Quote: ... For 3-color detection the following antibody dilutions were made: anti-digoxigenin (Roche, cat. 11333089001) 1:10 ...
-
bioRxiv - Molecular Biology 2024Quote: ... constructs in 6:3:1 weight ratios by X-Treme Gene HP Transfection Reagent (Roche) or the calcium phosphate method ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then 3-(4,5-dimethyl thiazol- 2-yl)-2,5-diphenyl tetrazolium bromide (MTT) labeling reagent (Roche) was added followed by solubilization buffer 2h later ...
-
bioRxiv - Microbiology 2020Quote: ... the DNA library of pDJB-3 plasmid prepared by KAPA Hyper Prep Kit (Roche, Basel, Switzerland) gave a pool of 150 bp paired-end reads that are destined to be assembled into a contig by the SPAdes Genome Assembler (version 3.11.0) ...
-
bioRxiv - Cell Biology 2022Quote: ... HeLa cells were reverse transfected with 1:3 or 1:6 X-tremeGENE 9™ (Roche) transfection reagent according to the manufacturer’s instructions.
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) with 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Physiology 2022Quote: ... 3 mM MgCl2) containing 0.5 % Triton X-100 and protease inhibitors cocktail (catalog no. 11873580001, Roche) and let chill on ice for 10 min ...
-
bioRxiv - Genetics 2021Quote: ... digested with NdeI and EcoRI using a 3-way ligation reaction (Rapid DNA ligation kit, Roche). This generated the intermediate plasmid pCMV-BE2+dCas9m4 ...
-
bioRxiv - Genetics 2020Quote: ... and the 3’ part with primers 8831F2 (CTGTCAAGCCACACCAGCAACAAGTGATTC) and 8831R2 (GACAGGTACCTATCACGATTGTCGCAGCTCGGGCAGTC) by PCR with Pwo (Roche) and sequenced ...
-
bioRxiv - Microbiology 2021Quote: Mouse lungs were isolated and placed in RPMI1640 containing Liberase Blendzyme 3 (70 μg/ml; Roche) and DNase I (50 μg/ml ...
-
bioRxiv - Immunology 2021Quote: ... washed in FACS buffer (4% FBS, 3 mM EDTA, and 40 μg/ml DNAse I (Roche)) and incubated with combinations of antibodies to CD45 (30-F11) ...
-
bioRxiv - Cancer Biology 2024Quote: ... The cells were resuspended and washed twice in 3 ml Red Blood Cell Lysis Buffer (Roche) to remove any visible blood cells ...
-
bioRxiv - Cell Biology 2024Quote: ... with primer set #3 (Supplementary Table 1) using KAPA High-Fidelity DNA Polymerase (KAPA Biosystems, KE2502). The forward and reverse primers contained BspEI and KpnII sites respectively ...
-
bioRxiv - Cell Biology 2024Quote: ... and incubated in digestion solution (3 mg/mL collagenase D [Roche] in DMEM/F-12 [Gibco]) for 45 min at 37 °C with intermittent vortex mixing to dislodge soft tissues ...
-
bioRxiv - Systems Biology 2023Quote: ... 500 mM NaCl and 3 mM Dithiothreitol (DTT)) supplemented with 1 mg deoxyribonuclease I (DNaseI, Roche) and protease inhibitor 4-(2-Aminoethyl ...
-
bioRxiv - Immunology 2023Quote: ... prior to gene expression analysis by real-time quantitative PCR (LightCycler, Roche; or QuantStudio 3, ThermoFisher). Quantitect SYBR green PCR mastermix (Qiagen ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 µg gDNA of each population was amplified using the KAPA HiFi ReadyMix PCR Kit (Roche) with the TKO outer Fw and Rv primers (Primers are listed in Supplementary Table 4 ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification with 21 cycles was conducted by adding 3 µL KAPA HiFi HotStart ReadyMix (Roche) and 0.05 µL IS PCR primer (10 µM ...
-
bioRxiv - Cell Biology 2024Quote: One million cells were initially lysed in 0.5% CHAPS (3-cholamidopropyl dimethylammonio 1-propanesulfonate) (Roche; #10810118001) in PBS (1x ...
-
bioRxiv - Cell Biology 2020Quote: ... per sample was washed 3 times with cold 1X PBS and 2μg anti-GFP monoclonal antibody (Roche) per sample was conjugated with Dynabeads in 1ml cold PBS at 4°C for 4h ...
-
bioRxiv - Genomics 2022Quote: ... 25µl of Red ANTI-FLAG M2 Affinity Gel from SIGMA ALDRICH (F2426) were washed 3 times with TBS (50mM TRIS pH 7.5,150mM NaCl and protease inhibitor tablets [Roche]) and then added to samples ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 µl Universal Nuclease Mix (Pierce™) and 1 tablet of cOmplete™ Protease Inhibitor Cocktail (Roche) were added and the cells were lysed via sonication ...
-
bioRxiv - Microbiology 2022Quote: ... at 37 °C for 3 hours followed by 19 μg/sample of trypsin (Roche Cat. Nr. 11418025001) at 37 °C for 13 hours ...
-
bioRxiv - Genetics 2020Quote: Exon 3 of the MSH2 gene was PCR amplified using the Expand High Fidelity PCR kit (Roche) with the following conditions ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 min) and plated onto 1.5 % agar TAP plate containing 10 µg mL-1 hygromycin B (Roche) and 20 µg mL-1 of paromomycin sulfate (Fisher BioReagents).
-
bioRxiv - Immunology 2020Quote: ... gently mechanically disaggregated and resuspended in PBS 1x containing 3 mg/ml of collagenase D (Roche Diagnostics) plus 10 μg/ml of DNAse (Sigma-Aldrich ...