Labshake search
Citations for Roche :
251 - 300 of 1836 citations for 3 O tert Butyldimethylsilyl 24 ethyl 24 phenylsulfonyl cholest 5 ene 3 ol d7 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: C2 myoblasts were transfected 18-24 h after plating at 70-80% confluence by using FuGENE 6 (Roche Diagnostics, Indianapolis, IN) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: ... for 2 hours at room temperature and left to incubate for 24 hours with blocking buffer containing a 1:200 dilution of anti-DIG (Roche, 11207733910) or anti-fluorescein antibody conjugated with POD (Roche ...
-
bioRxiv - Neuroscience 2022Quote: ... tissue sections were rinsed three times within 24 h with PBS plus Triton X-100 (PBST; 0.1% (vol/vol) Triton X-100 (Roche, Mannheim, Germany)) under gentle agitation at room temperature ...
-
bioRxiv - Biophysics 2022Quote: ... A total of 24 μL of the qPCR mastermix was aliquotted in each well of a 96-well lightcycler plate (Roche 96) and 1 μL of RT reaction was aliquoted in each well ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A universal primer was annealed to the barcoded adapter and one of 24 indexed primers was annealed to the universal adapter followed by PCR amplification using KAPA HiFi Hotstart Readymix (Kapa BioSystems). This design ensured that only DNA sequences with both ligated adapters will be sequenced ...
-
bioRxiv - Molecular Biology 2021Quote: ... treated with 5.8 μl of proteinase K (24 mg/mL, P4850) for 45 min at 55°C followed by 50 μg/ml RNase A (Roche, 10109169001) for 1 h at 37°C plus 1 h at 65°C ...
-
bioRxiv - Cell Biology 2021Quote: Adult fish were fasted for 24 hours then euthanized with tricaine and the glycemia was immediately measured using the Accu-Chek Aviva glucometer (Roche Diagnostics) with blood collected at the tail.
-
Ribosomal quality control factors inhibit repeat-associated non-AUG translation from GC-rich repeatsbioRxiv - Molecular Biology 2023Quote: ... each well of cells from 24-well plates was lysed with 120 μL of RIPA buffer with protease inhibitor (Roche, 11836153001). All protein lysates were denatured with 12% β-mercapto-ethanol in 6x SDS-loading dye ...
-
bioRxiv - Microbiology 2022Quote: Single cell suspensions from the ear were obtained by using tweezers to separate the dorsal and ventral sides of the mouse ear and placing the sheets dorsal-side down in a 24 well plate with 1 mL/well of RPMI1640 containing 0.25 mg/mL of Liberase TL (Roche, Diagnostics Corp.) and 10 μg/mL of DNase I (Sigma-Aldrich) ...
-
bioRxiv - Bioengineering 2024Quote: ... the cells were harvested from the matrices by digesting the collagen with liberase DL research grade (24 U; Roche, Basel, Switzerland). The cells were then fixed with 4% PFA ...
-
bioRxiv - Bioengineering 2024Quote: ... the cells were harvested from the matrices by digesting the collagen with liberase DL research grade (24 U; Roche, Basel, Switzerland). The cells were then fixed with 4% PFA ...
-
bioRxiv - Microbiology 2024Quote: ... The qPCR experiments were performed using specific oligonucleotide primers previously described[24] and hot-start polymerase (SYBR Green Fast Master Mix; Roche Diagnostics). The amplification cycles were performed using a C1000 Touch Thermal cycler (Biorad) ...
-
bioRxiv - Bioengineering 2022Quote: ... Encapsulated or adherent cells were plated in a 96 well plate for 24 or 48h when WST-1 reagent (Roche, Switzerland) was added ...
-
bioRxiv - Cell Biology 2024Quote: HEK293T cells were seeded at 30 000/45 000 cells/cm2 and transfected 24 h after with plasmids (pcDNA3.1-GFP, MPV17-HA or MPV17) preincubated with XTremeGENE HP Transfection Reagent (Roche, Basel, Switzerland) for 30 min at room temperature in Opti-MEM I serum-free medium (ThermoFisher Scientific ...
-
bioRxiv - Immunology 2024Quote: ... sciatic nerves and brains were crushed with the back of a 3ml syringe in a serrated 24 well plate and triturated in digestion media (Liberase TM (0.208 WU/ml) (Roche Cat # 054010200001) and DNase I (40 ug/ml ...
-
bioRxiv - Cell Biology 2020Quote: ... 1X Proteinase Inhibitor w/o EDTA (Roche), 0.4U μl-1 RNaseIn (ThermoFisher ...
-
bioRxiv - Neuroscience 2020Quote: ... protease inhibitors w/o EDTA (Roche #11836170001), 0.1 mM EDTA (AmericanBio #AB00502) ...
-
bioRxiv - Neuroscience 2020Quote: ... protease inhibitors w/o EDTA (Roche #11836170001), RNAse inhibitor (80U/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... protease inhibitors w/o EDTA (Roche #11836170001), RNAse inhibitor (80U/mL ...
-
bioRxiv - Neuroscience 2020Quote: ... protease inhibitors w/o EDTA (Roche #11836170001), RNAse inhibitor (80U/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... protease inhibitors w/o EDTA (Roche #11836170001), RNAse inhibitor (80U/ml ...
-
bioRxiv - Neuroscience 2020Quote: ... protease inhibitors w/o EDTA (Roche #11836170001), 0.1 mM EDTA (AmericanBio #AB00502) ...
-
bioRxiv - Neuroscience 2020Quote: ... protease inhibitors w/o EDTA (Roche #11836170001), RNAse inhibitor (80U/ml ...
-
bioRxiv - Cell Biology 2021Quote: ... complete protease inhibitor w/o EDTA (Roche), 0.5mM PMSF ...
-
bioRxiv - Cell Biology 2021Quote: ... complete protease inhibitor w/o EDTA (Roche), 0.5mM DTT) ...
-
bioRxiv - Cell Biology 2021Quote: ... complete protease inhibitor w/o EDTA (Roche), 0.5mM DTT ...
-
bioRxiv - Cell Biology 2021Quote: ... complete protease inhibitor w/o EDTA (Roche), 0.5mM DTT) ...
-
bioRxiv - Cell Biology 2021Quote: ... complete protease inhibitor w/o EDTA (Roche), 0.5mM DTT ...
-
bioRxiv - Neuroscience 2021Quote: Sections from adra1A KO mice were rinsed with PBS (3 × 5 min) and incubated in a β-gal staining solution (Roche, Ref # 11828673001) overnight ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5-bromo-4-chloro-3-indolylphosphate (BCIP) and nitroblue tetrazolium chloride (NBT) according to the manufacturer’s protocol (Roche Applied Science, Indianapolis, IN, USA). The sections were then mounted ...
-
bioRxiv - Developmental Biology 2020Quote: ... for 16-20h incubation at room temperature and colorimetric signals were detected using Nitro blue tetrazolium chloride and 5-bromo-4-chloro-3-indolyl phosphase (NBT-BCIP; Roche Applied Sciences 11383221001). RNAScope ISH was conducted for FGF15 and Ptch1 ...
-
bioRxiv - Cell Biology 2024Quote: ... 72°C for 3 min and final 72 °C for 5 min) using KAPA HiFi Hotstart Readymix PCR Kit (Kapa Biosystems, Cat: KK2602) and SMART PCR Primer (AAGCAGTGGTATCAACGCAGAGT) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Antimouse secondary antibodies conjugated with alkaline phosphatase was used to detect color signal formed by BCIP/NBT (5-bromo-4-chloro-3-indolyl phosphate/nitroblue tetrazolium) substrates (Roche Biochemical, Mannheim, Germany).
-
bioRxiv - Cancer Biology 2021Quote: ... Total cell lysates from COS-1 cells 24 hr post transfection were prepared using 300 μl of KAc interaction buffer (Roche Applied Science). GST fusion proteins were bound to glutathione-Sepharose beads (GE Healthcare ...
-
bioRxiv - Molecular Biology 2021Quote: ... were transiently transfected for 24 h with 9,36 μg of hNAA40-flag expression vectors and using 35 μl Fugene HD (Roche, cat. n°04709705001) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2021Quote: ... Transfection with full-length nV5-WT or nV5-P112L (0.8 μg DNA/well) was performed 24 h post-seeding using X-tremeGENE™ 9 DNA Transfection Reagent (Roche, Basel, Swityerland). 24 h post-transfection ...
-
bioRxiv - Plant Biology 2021Quote: ... Target DNA capture was performed as previously described (24) with slight modifications using a SeqCap EZ Hybridisation Wash Kit (Nimblegen/Roche, Madison, USA) and Dynabeads M-270 Streptavidin (Thermo Fisher Scientific ...
-
bioRxiv - Microbiology 2020Quote: ... the LDH release in cell culture supernatant from infected cells was measured at 24 h and 96 hpi by using the colorimetric kit (Roche, Mannheim, Germany) and following the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... Blood glucose was measured 24 hours after injection to confirm conversion (>12 mmol/L; Accu-Chek Go, Roche Diagnostics, North Ryde, Australia). Weight and blood glucose levels were measured biweekly and STZ-treated animals received 2 units of insulin subcutaneously when blood glucose was ≥ 30 mmol/L (Novartis Pharmaceuticals Australia Pty ...
-
bioRxiv - Immunology 2023Quote: ... the dorsal and ventral layers of the ear were split mechanically and placed dermis side down in a 24 wells plate with 500 μl/well of RPMI with 250 mg/mL of Libarase (Roche, Cat #05401054001) and 10 mg/mL of DNase I (Sigma-Aldrich ...
-
bioRxiv - Cancer Biology 2024Quote: ... we treated sensitive and resistant cells with increasing concentrations of SP600125 for 24 hours and evaluated the cell viability using the Cell Proliferation Kit I (MTT) (Roche, Cat. 11465007001) and measuring the absorbance value at λ=590nm ...
-
bioRxiv - Microbiology 2023Quote: ... HEK293T/17 cells were seeded onto a 6-well plate and then transfected 24 h later using X-tremeGENE HP (Roche, Basel, Switzerland). After transfection (24 h ...
-
bioRxiv - Cancer Biology 2023Quote: ... Cells were treated with dilutions of SB939 for 24 or 48 hours and cell proliferation was assessed using ELISA BrdU kit (Roche Diagnostics GmbH), according to manufacturer’s protocol.
-
bioRxiv - Plant Biology 2021Quote: ... was isolated from the cDNA of juvenile cluster root tissues from P-deficient plants using the 5’/3’ RACE Kit (2nd generation, Roche Diagnostics S.p.a., Monza, Italy) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2023Quote: ... The PCR primer for generating the probe was 5’-GGTTCTGTGATTGAGTGTTTGGATCTCCCTGCG-3’ with a single-end CY3 tag generated using the DIG RNA Labeling Kit (Roche Applied Science, Penzberg, Germany) based on the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2024Quote: ... and phoC-A-R1 (5’-CAA CAT CGC TTT GCC AGT G-3’) (Fraser et al., 2017) with a Roche LightCycler® 96 (Roche Diagnostics, Mannheim, Germany) using 5 µL KAPA SYBR FAST 2x qPCR Master Mix (KAPA Biosystems ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM phenylmethanesulphonylfluoride (PMSF) and complete Mini protease inhibitor cocktail (Roche). Following lysis ...
-
bioRxiv - Cell Biology 2022Quote: ... DNA (1 μg) was mixed with 3 μl Fugene6 (Roche, #11836145001) in 200 μl opti-MEM (Gibco ...
-
bioRxiv - Molecular Biology 2020Quote: ... then equilibrated for 3 min in detection buffer (Roche, Catalog# 11585762001). Signals were visualized with CDP-Star Ready-to-Use (Roche ...
-
bioRxiv - Microbiology 2020Quote: ... and BCIP (1,5-bromo-4-chlooro-3-indolyl-phosphate, Roche, Switzerland).