Labshake search
Citations for Roche :
351 - 400 of 953 citations for 3 Chloro phenyl 9H fluoren 9 ylmethoxycarbonylamino acetic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2024Quote: ... Detection was accomplished using the DIG Nucleic Acid Detection Kit (Roche). Images were quantified using ImageJ ...
-
bioRxiv - Biochemistry 2021Quote: ... 5mM CHAPS (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate) and 1 tablet of Protease Inhibitor Cocktail (ROCHE, cOmplete™). The preparation was sonicated for 120 s on ice ...
-
bioRxiv - Biochemistry 2021Quote: ... Transfection with full-length nV5-WT or nV5-P112L (0.8 μg DNA/well) was performed 24 h post-seeding using X-tremeGENE™ 9 DNA Transfection Reagent (Roche, Basel, Swityerland). 24 h post-transfection ...
-
bioRxiv - Microbiology 2020Quote: ... G355-5 cells were transfected with 1 to 6 µg DNA in 6 cm dishes using X-treameGENE 9 (Roche, Basel, Switzerland). The 293T/17 cell line was obtained from ATCC (CRL-11268 ...
-
bioRxiv - Physiology 2021Quote: Pancreases were rapidly dissected after intra-ductal injection from 9-10 week-old male mice and islets were isolated by digesting the pancreas with collagenase P (Roche, Basel, Switzerland) and purified using a Ficoll gradient (Merck Biochrom ...
-
bioRxiv - Developmental Biology 2020Quote: The testes from ten to twelve 19dpc embryos form 9 different mothers were collected and dissociated using collagenase/dispase (Roche, 1mg/ml), at 37°C ...
-
bioRxiv - Cell Biology 2023Quote: ... UGGT2-/- and UGGT1/2-/-cells were transfected with 1 µg Trop-2-pEYFP-N1 or Trop-2-Q118E-pEYFP-N1 plasmids using X-tremeGENE 9 DNA transfection reagent (Roche, Basel, Switzerland) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: 293T cells were co-transfected with plasmids encoding cognate heavy and light chains using the Xtreme Gene 9 DNA transfection reagent (Roche, Basel, Switzerland), then grown in Dulbecco’s modified Eagle medium supplemented with 10% fetal bovine serum (FBS ...
-
bioRxiv - Immunology 2023Quote: The retroviral packaging cell line Platinum-E was co-transfected with pMXs-SOX2-IP or pMXs-IP using the DNA Transfection Reagent X-TremeGene 9 (ROCHE, Cat# 06365779001) and following the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... Nuclei pellets were resuspended in 100 µl of nuclei lysis buffer (20 mM HEPES pH 7.9, 0.1 M NaCl, 1mM EDTA, 1 mM EGTA, 1mM DTT, 25 % glycerol, 0.5 mM AEBSF, 1×Roche complete protease inhibitor cocktail) for 20 min at 4 °C with rotation ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 μg of ant-HA antibody (Roche) was added and mixed at 4ºC for 1 h ...
-
bioRxiv - Microbiology 2020Quote: ... Universal probe library (UPL) probe #3 (Roche) and following primers were used for analysis of wtAAV2 ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3 µL 10% Tween-20 (Roche 11332465001), freshly add 3 µL 1:1 water diluted digitonin (Promega G9441) ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 10 mM CaCl2 for 45 min at 37 °C ...
-
bioRxiv - Cancer Biology 2023Quote: ... 3 mg/mL Dispase II (Roche, 04942078001), and 0.1 mg/mL DNase I (Sigma ...
-
bioRxiv - Cell Biology 2023Quote: ... 3 U ml-1 Dispase II (Roche), and 5 mM CaCl2 for 45 min at 37 °C with shaking ...
-
bioRxiv - Neuroscience 2023Quote: ... retigabine (3 mg/kg, Roche Pharmaceuticals, CH), nicotine (5 mg/kg ...
-
bioRxiv - Genomics 2024Quote: ... negative selection with 3 μM Ganciclovir (Roche) was carried out for 10 days ...
-
bioRxiv - Neuroscience 2020Quote: ... 5’-CAGACACGCAGACTCTTTC-3’) and 2.5 µl reverse primer (10 µM; 5’-CTAAAGATGTGTGTCTTCCTCA-3’) using the Expand Long Template PCR System (Roche). The PCR conditions were 35 cycles at 95°C for 30 sec ...
-
bioRxiv - Cell Biology 2022Quote: ... with 0.5μM of each primer (Forward: 5’-GGGAGCCTGATCCTATCGTT-3’; Reverse: 5’-TCCCAAAGCACAGCTTCC-3’) and 50nM Universal ProbeLibrary Probe #67 (Roche). RT-PCR was performed in QuantStudio™ 5 Real-Time PCR System (Thermo Fisher Scientific ...
-
bioRxiv - Molecular Biology 2020Quote: ... in Tris calcium buffer with ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor (Roche) were added and the pellet resuspended ...
-
bioRxiv - Genetics 2021Quote: ... with the MagNA Pure Compact Nucleic Acid Isolation Kit I (Roche Diagnostics) according to the manufacturer’s instructions.
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Total RNA was isolated via MPLC Total Nucleic Acid Isolation Kit (Roche) using automated MagNA Pure LC Instrument (Roche) ...
-
bioRxiv - Genetics 2020Quote: ... acid-extracted histones were digested with Asp-N and Arg-C (Roche) and the resulting digests were analyzed by chromatography on an Ultimate 3000 nanoLC (Dionex ...
-
bioRxiv - Microbiology 2020Quote: Escherichia coli MRE600 total transfer ribonucleic acid was purchased from Roche (Switzerland). Biotin labeled single-stranded DNA oligonucleotides were obtained from B.G.I. ...
-
bioRxiv - Neuroscience 2024Quote: ... ethylenediaminetetraacetic acid (EDTA)-free protease inhibitor cocktail tablets (plus protease inhibitors) (Roche). For experiments where separate measurements were made in ganglia versus neurites ...
-
bioRxiv - Cell Biology 2024Quote: ... and 0.1% Na-deoxycholic acid) supplemented with protease and phosphatase inhibitors (Roche) and Benzonase® Nuclease (Sigma-Aldrich ...
-
bioRxiv - Genetics 2024Quote: ... 1×EDTA (Ethylene Diamine Tetraacetic Acid)-free protease inhibitor cocktail (Roche 04693132001). The larvae were then crosslinked by adding formaldehyde to a 1.8% concentration and incubating for 5mins at RT on a rotator ...
-
bioRxiv - Genomics 2020Quote: ... 2 g of DUX4 expression constructs were transfected into RD cells with 6 L of the X-treme GENE 9 DNA transfection reagent (cat. XTG9-RO, Roche Diagnostics, Indianapolis, USA) diluted in 100 L of Opti-MEM I (Gibco ...
-
bioRxiv - Bioengineering 2023Quote: ... was subjected to second-strand synthesis in a 25 μl reaction volume using IGHV gene–specific primers (primer No.9–14) and a KAPA Biosystems kit (Roche, KAPA HiFi HotStart). The PCR conditions were as follows ...
-
bioRxiv - Developmental Biology 2024Quote: ... 100 ng of the purified products was PCR-amplified for 8-9 cycles using KAPA HiFi HotStart 2x ReadyMix (Kapa Biosystems, Cat. KK2602). The amplified products were again purified using 0.4 volume of Agencourt AMPure XP Beads to produce the SMRTbell Template ...
-
bioRxiv - Microbiology 2021Quote: The mpsB gene was amplified by PCR from JE2 genomic DNA using the primers mpsB FW 5’ atatagatctgaagaagtatttataggaggtgaaagg 3’ and mpsB RV 5’ tgaattcgagctcagatacttagcatcgcaacatatcatc 3’ and KAPA HiFi polymerase (Roche). The PCR product was cloned into the tetracycline inducible plasmid pRMC2 using BglII and SacI restriction sites and T4 DNA ligase (NEB ...
-
bioRxiv - Cell Biology 2023Quote: ... 0.5% Zwittergent 3-12 (N-dodecyl-N,N-dimethyl-3-ammonio-1-propanesulfonate) and protease inhibitor (Complete, Roche Applied Science)) for 2 h at 0°C (ref A) ...
-
bioRxiv - Neuroscience 2022Quote: ... were transfected into HEK293 cells at a ratio of 3:3:1 (hGluN1/hGluN2A/EGFP) using X-tremegene HP (Roche) at a 1:100 ratio with optiMEM ...
-
bioRxiv - Developmental Biology 2022Quote: ... Probe was prepared by PCR amplification using forward primers LL/F 5′-TACGGACACAGGTCGAATCCCCTACTACC-3′ and reverse primer LL/R 5′-ACAGAGAAGAGGCTAATGTGTGCAC-3′ in the presence of DIG (Roche). PCR-products were resolved in a 1.2 % agarose Ethidium bromide-stained gel ...
-
bioRxiv - Microbiology 2024Quote: ... 5’- AAACTCAAAKGAATTGACGG-3’ /1062R: 5’-CTCACRRCACGAGCTGAC-3’, (Bacchetti De Gregoris et al., 2011) on a LightCycler 480 Instrument II (Roche). The global predicted coverage of this primer pair is 94.1% of all bacterial sequences present in Silva SSU r138.1 (Silva Testprime with only one mismatch allowed ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR amplification of the re-purified circular fragments have been performed using View-Point specific primers (Reading Primer: 5’-tacacgacgctcttccgatctAACTCGATTTGGAGCGATC-3’; Non-reading Primer: 5’-actggagttcagacgtgtgctcttccgatctCTGGGACTGCACTTGCTC-3’) using the Expand Long Template PCR System (Roche). Amplicons were purified with AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Developmental Biology 2024Quote: ... knee cartilage was harvested from postnatal day 3-5 mice and treated with 3 mg/ml collagenase D (11088866001, Roche) in DMEM (10569010 ...
-
bioRxiv - Cell Biology 2020Quote: ... 3 mM 1,4-Dithiothréitol (DTT) (Roche, Basel, Switzerland), 10 µM ROCK inhibitor Y27632 (ATCC® ACS-3030™ ...
-
bioRxiv - Molecular Biology 2021Quote: ... 3 protease inhibitor tablets (Roche, cat. No. 11836153001) and 1 ml BioLock (IBA ...
-
bioRxiv - Biochemistry 2020Quote: ... 3 tablets of EDTA-free cOmplete inhibitor (Roche) were added to the media which was then centrifuged at 14,000 × g for 30 min at 4°C ...
-
bioRxiv - Neuroscience 2021Quote: ... 3 mg/ml Dispase II (Roche, Indianapolis, IN), and 1 mg/ml trypsin inhibitor (Sigma ...
-
bioRxiv - Biochemistry 2021Quote: ... 3 tablets complete protease inhibitor EDTA free (Roche) and 1 tablet PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 3) Complete protease inhibitor cocktail (Roche, cat #11836153001) was included for final 1X concentration ...
-
bioRxiv - Molecular Biology 2023Quote: ... or Adenosine-5’-O-(3-thiotriphosphate) (Roche, 11162306001), 1.5 μL of TF buffer ...
-
bioRxiv - Genetics 2023Quote: ... and dithiothreitol (Roche; cat. no. 3483-12-3). Lysates were rocked at 4° C for 20 min and centrifuged for 10 min at 15,000 × g ...
-
bioRxiv - Microbiology 2024Quote: ... with buffer 3 or the Taq polymerase (Roche). The initial denaturation for Taq polymerase at 95 °C for 5 min was followed by 30 amplification cycles of 1 min at 95 °C ...
-
bioRxiv - Molecular Biology 2024Quote: ... 3 U/ml dispase II (Roche Diagnostics, 4942078001), and 10 mM CaCl2 for 30 min at 37 °C with occasional shaking ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP (Roche) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Complete EDTA-free protease inhibitor cocktail 3 (Roche), and PhosSTOP phosphatase inhibitor Cocktail (Roche) ...