Labshake search
Citations for Roche :
151 - 200 of 953 citations for 3 Chloro phenyl 9H fluoren 9 ylmethoxycarbonylamino acetic acid since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Molecular Biology 2022Quote: ... Transfections were performed using X-tremeGENE 9 DNA Transfection Reagent (Roche) (3:1 ratio of reagent to DNA ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with DNA using Xtreme-GENE 9 DNA (Roche) or with TransIT-HeLaMonster (Mirus ...
-
bioRxiv - Microbiology 2024Quote: ... The X-treme Gene 9 (X9) DNA transfection reagent (Roche: 6365809001) was added 1:3 as DNA:X9 added to the plasmid dilution and mixed properly ...
-
bioRxiv - Systems Biology 2024Quote: ... The library was amplified for 9 cycles with Kapa polymerase (Roche) using the oligonucleotides 5’ tagtggtagaaccaccgcttgtc and 5’ actttttcaagttgataacggactagcc and assembled into pCRISPRpp linearized by BbvCI digestion ...
-
bioRxiv - Neuroscience 2023Quote: ... Transient transfection was carried out using X-tremeGENETM 9 reagent (Roche) following manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... 2013) and were transfected using XtremeGENE 9 DNA Transfection reagent (Roche) at a concentration of 200 ng/ml (unless otherwise stated ...
-
bioRxiv - Immunology 2024Quote: ... was transfected into HEK293T cells using X- tremeGENE™ 9 (Roche) with psPAX2 (1.625 μg ...
-
bioRxiv - Cancer Biology 2020Quote: ... Linoleic acid (C18) complexed with fatty acid free BSA (Roche 10775835001). PBS and BSA were used as the vehicle control in experiments containing C8 and C18 respectively ...
-
bioRxiv - Immunology 2021Quote: ... was incubated with 50μl MTT (sodium 3′-[1-(phenylaminocarbonyl)-3,4-tetrazolium]-bis (4-methoxy-6-nitro) benzene sulfonic acid hydrate) labeling reagent (Roche Life Science, USA) to each well ...
-
bioRxiv - Developmental Biology 2022Quote: ... Sections were re-fixed in 4% PFA for 5 min and incubated in 0.2 M HCl for 10 min at RT before treatment with tri-ethanolamine buffer (662.5 µl tri-ethanolamine, 112 µl 1 M HCl, 49.1 µl H2ODT, 125 µl acetic anhydride; Roche). Slides were preincubated at 65°C in hybridization buffer (50% formamide (Sigma-Aldrich) ...
-
bioRxiv - Developmental Biology 2022Quote: ... testis albuginea was peeled and added in RIPA buffer supplemented with 1mM phenyl methyl sulfonyl fluoride (PMSF) and PIC (Roche Diagnostics, 04693132001), the solution was sonicated transiently and then on the ice for 30 min ...
-
bioRxiv - Developmental Biology 2021Quote: ... DNA transfection was performed using X-tremeGENETM 9 DNA transfection reagent (Roche) in OptiMEM media according to the manufacturer’s instructions.
-
bioRxiv - Cell Biology 2020Quote: ... The transfection was performed using X-tremeGENE 9 DNA transfection reagent (Roche) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2022Quote: ... Lentiviral helpers and constructs were transfected using X-tremeGENE 9™ (Roche) according to the manufacturer’s instructions at a 1:3 ratio ...
-
bioRxiv - Cell Biology 2022Quote: ... The plasmid was transfected into H1 hESCs with XtremeGene 9 (Roche, 6365787001), and 24 h later 5000 GFP+ cells were sorted into a well of six-well plate using mTeSR1 medium supplemented with 10 µM Y-27632 ...
-
bioRxiv - Cell Biology 2020Quote: ... Transfections were performed using the X-tremeGENE 9 Transfection Reagent kit (Roche) to introduce 1-2 μg of plasmid DNA as per manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: Plasmid transfections were performed using X-tremeGENE 9 DNA transfection agent (Roche) according to the manufacturer’s protocol ...
-
bioRxiv - Cell Biology 2021Quote: ... plasmids were transfected using X-tremeGENE 9 DNA transfection reagent (Roche, 6365787001) following the manufacturer’s protocol (1 μg plasmid ...
-
bioRxiv - Neuroscience 2023Quote: ... Transfections were performed using X-tremeGENE 9 DNA transfection agent (Roche Diagnostics). Full-length human TREK-1(TREK-1 FL ...
-
bioRxiv - Cell Biology 2024Quote: ... two steps of transfections were performed: DNA using XtremeGENE™ 9 (Roche) followed by siRNA (4392420-s30722 ...
-
bioRxiv - Genetics 2024Quote: ... and viral envelope vector gag-pol using XtremeGene 9 transfection reagent (Roche). Collection of viral particles and transduction was performed as described for lentiviral particles ...
-
bioRxiv - Immunology 2024Quote: ... catalog number 2708) using the X-tremeGENE 9 DNA Transfection Reagent (Roche) according to manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2023Quote: ... RPE1 cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche) according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2023Quote: The TetR-eYFP tagged proteins were transfected using the XtremeGene-9 (Roche) transfection reagent according to the manufacturer’s protocol ...
-
bioRxiv - Physiology 2022Quote: ... 150 ng of each plasmid were transfected with X-tremeGENE 9 (Roche) in C2C12 myoblasts immediately after trypsinization (47) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Transfection was performed using X-tremeGENE 9 Transfection Reagent (XTG9-RO; Roche) following manufacturer’s instructions into HEK293T cells ...
-
bioRxiv - Microbiology 2023Quote: ... Nucleic acids were extracted using the High Pure Viral Nucleic Acid Kit (Roche) according to the manufacturer’s recommendations.
-
bioRxiv - Biochemistry 2020Quote: ... Transient transfection of cells was performed with the X-tremeGENE 9 reagent (Roche) or polyethylenimine (PEI ...
-
bioRxiv - Cancer Biology 2020Quote: ... pCIN4-HA-ARID1A was transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche), followed by selection with G418 (Gibco) ...
-
bioRxiv - Molecular Biology 2020Quote: ... Transfections were carried out using X-tremeGENE 9 DNA transfection reagent (Roche Diagnostics) following manufacturer’s instructions.
-
bioRxiv - Neuroscience 2020Quote: IMCD3 cells were transfected using X-tremeGENETM 9 DNA Transfection Reagent (06365809001, Roche). The transfection reagent was diluted in OptiMEM (Life Techonologies ...
-
bioRxiv - Cancer Biology 2020Quote: ... The DF1s were transfected with various RCAS plasmids using X-TremeGENE 9 (Roche). Primary brainstem gliomagenesis was induced by injecting NestinTVA mice (postnatal days 3-5 ...
-
bioRxiv - Biophysics 2021Quote: ... the cells were transfected using X-tremeGENE 9 DNA Transfection Reagent (Roche, Germany) with a plasmid encoding γ-actin N-terminally tagged with green fluorescent protein (GFP) ...
-
bioRxiv - Cancer Biology 2021Quote: ... and for immunohistochemistry with antibodies against Ki-67 (RTU, clone 30-9, Roche) and caspase-3 (1:2000 ...
-
bioRxiv - Cell Biology 2023Quote: ... cells were lipofected with pLacO using X-tremeGENE 9 DNA Transfection Reagent (Roche). The plasmid:transfection reagent ratio (w:v ...
-
bioRxiv - Neuroscience 2023Quote: ... together with Renilla-TK luciferase vector using X-tremeGENE 9 transfection reagent (Roche). The Atp6v1h promoters were cloned into pGL3 plasmid (Promega) ...
-
bioRxiv - Genetics 2024Quote: ... and lentiviral envelope vector CMV VSV-G using XtremeGene 9 transfection reagent (Roche). Viral particles were collected 48h after transfection and passed through a 0.45 μm filter to eliminate cells and cell debris ...
-
bioRxiv - Microbiology 2022Quote: ... 9016-45-9]) supplemented with complete protease inhibitor cocktail (cOmplete, EDTA free; Roche) and phosphatase inhibitor (PhosSTOP ...
-
bioRxiv - Cell Biology 2023Quote: ... Cells were transfected with X-tremeGENE 9 DNA Transfection Reagent (Roche, Basel, Switzerland) following manufacturer’s instructions.
-
bioRxiv - Cell Biology 2024Quote: ... HCT116 and U2OS cells were transfected with X-treme-GENE-9 (Roche, 06365787001), FuGENE-HD (Promega ...
-
bioRxiv - Biochemistry 2022Quote: ... 2 mM amino acids (Roche), 1 nM pY71sfGFP plasmid encoding superfolder GFP (M ...
-
bioRxiv - Molecular Biology 2020Quote: ... Plasmid transfections were carried out using X-tremeGENE 9 DNA transfection reagent (Roche Diagnostics) following manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... Vectors were transfected into HEK293FT cells using X-tremeGENE 9 DNA Transfection Reagent (Roche). Retroviral supernatants isolated at 48 h were diluted 1:1 in culture medium and used to infect the ARID1A-wildtype ES2 and KLE cell lines ...
-
bioRxiv - Cell Biology 2021Quote: ... Ki-67 (rabbit monoclonal, clone name 30-9, Ventana Roche, 790-4286, 1:400), cleaved caspase 3 (rabbit monoclonal ...
-
bioRxiv - Cell Biology 2021Quote: ... Transient transfections with B16-F1 cells were carried out with X-tremeGene 9 (Roche) and replaced with normal growth media 4-6 hours after transfection ...
-
bioRxiv - Microbiology 2020Quote: ... and precB5R-N+GPC by using X-tremeGENE 9 (Roche Diagnostics K.K., Tokyo, Japan). Cells transfected with each plasmid were then infected with m8 at a multiplicity of infection (MOI ...
-
bioRxiv - Molecular Biology 2023Quote: ... The plasmids were transfected into HEK293T cells using X-tremeGENE 9 (Roche # XTG9-RO) as per the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The residual 9 μL cDNA were subsequently amplified using Kapa HiFi HotStart Readymix (Roche) at a 1x concentration together with 250 nM UP-primer (Table S2 ...
-
bioRxiv - Cancer Biology 2023Quote: ... The samples were immunostained for Ki67 (clone 30-9 at 1:7, Ventana- Roche), CD8 (clone SP57 at 1:7 ...